Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FTO gene clone relating to pig meat quality trait and application of the same as molecular marker

A technology of muscle quality and traits, applied in the field of livestock genetic engineering, can solve problems affecting pig fat deposition and pork quality

Inactive Publication Date: 2009-03-25
HUAZHONG AGRI UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, the research on the pig FTO gene has not yet been carried out, and whether the gene affects the fat deposition of pigs, thereby affecting the quality of pork is not yet known

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FTO gene clone relating to pig meat quality trait and application of the same as molecular marker
  • FTO gene clone relating to pig meat quality trait and application of the same as molecular marker
  • FTO gene clone relating to pig meat quality trait and application of the same as molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Nucleotide sequence cloning and SNP scanning of embodiment 1 FTO gene

[0022] 1. cDNA cloning of FTO gene

[0023] (1) Primer design

[0024] Using the mRNA sequence (GenBank accession number: NM_001080432) of the human FTO gene as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank pig EST database, a series of ESTs with more than 90% homology were obtained ( Fragment length greater than 100bp), using the SeqMan program in DNAStar software to construct porcine FTO gene EST-contigs, and accordingly designed for 5'RACE and 3'RACE and for the coding region (CDS) and 3'untranslated region ( 3'UTR) amplified primer, the primer DNA sequence is as shown in table 1:

[0025] Table 1: Primer sequence design for FTO gene cDNA cloning

[0026]

[0027]

[0028] (2) RACE and RT-PCR amplification

[0029] Referring to the instructions of the TriZoL kit (product of U.S. GIBCO Company), the total RNA was extracted from the muscl...

Embodiment 2

[0038] Example 2 Detection of genetic diversity of FTO gene A37G Bsh1236I PCR-RFLP genotype and association analysis with meat quality traits

[0039] 1. Establishment of Bsh1236IPCR-RFLP detection method

[0040] (1) Primer design

[0041] Aiming at the 90bp A-G base mutation found in the third exon, the following amplification primers were designed:

[0042] FTO-S: 5'GGGACTCCACAAAGAGGTTCA3',

[0043] FTO-R: 5'TTGCATCAGAGCCCTTCACT3'.

[0044] According to the location of the mutation site at the 37th position in the amplified fragment, this mutation was named A37G.

[0045] (2) PCR amplification conditions

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention pertains to the technical field of livestock genetic engineering and particularly relates to a molecular marker which is applied to the marker auxiliary select and application of pigs and related to the characteristics of the muscle quality of the pigs, and an application thereof. The molecular marker is cloned by an FTO gene and the cDNA sequence of the molecular marker is shown in a sequence table SEQ ID NO: 1. The substitution of a basic group A37-G37 occurs at the 37th bp of the sequence table SEQ ID NO: 2, which causes the enzyme digestion polymorphism of Bsh1236I PCR-RFLP. The invention also discloses a complete cDNA sequence for amplifying the FTO gene, a primer used by a part of the DNA sequence and a method for testing the polymorphism, thereby providing a new molecular marker for the marker auxiliary select of the pigs.

Description

technical field [0001] The invention belongs to the technical field of livestock genetic engineering, and in particular relates to the cloning of an FTO gene related to pig muscle quality and its application as a molecular marker. Background technique [0002] Pork is the main source of animal protein for our people. In the past few decades, with the introduction of high-lean meat percentage and fast-growing breeding pigs from abroad, my country's pork production has gradually met the market demand in terms of quantity. However, breeding pigs bred with overselection for leanness and growth velocity are inferior to Chinese local pigs in terms of muscle quality. With the improvement of living standards and the change of consumption concept, lean meat with good color, aroma and taste, safe and nutritious is more and more favored by consumers. Therefore, the improvement of muscle quality has become an important goal of high-quality pig breeding work, and the search for related...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12Q1/68C12N15/11C12N15/10
Inventor 徐学文张莹刘榜赵书红李奎樊斌朱猛进余梅
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com