Upland cotton disease-resistant gene and use thereof

[0057] Example 1 Cloning of Gh-npr1 gene

[0058] 1.2.1 Cloning of Gh-npr1 gene fragment

[0059]Cotton DNA was extracted by the improved CTAB method, and degenerate primers p-F1 (5'agg cac(t)tt(g)g ac(t)t cng atg ata(g)tt( a)g a3'), p-R1(5'tcc(t)c(t)tc(a,t)cg(t)c ata(c)gcagca at(c)g(a)tga ag3'), Gene fragments were amplified by Touch-Down PCR. PCR reaction conditions were: 94°C for 5 min; 94°C for 30sec, 60°C for 30sec, 72°C for 1min, 2 cycles; 94°C for 30sec, 58°C for 30sec, 72°C for 1min, 2 cycles; 94°C for 30sec, 56°C for 30sec, 72°C for 1min, 2 cycles; 94°C for 30sec, 54°C for 30sec, 72°C for 1min, 2 cycles; 94°C for 30sec, 52°C for 30sec, 72°C for 1min, 30 cycles; extension at 72°C for 5min. 1.2.2 Obtaining the 3' end of Gh-npr1 gene cDNA.

[0060] The specific primer primer F2: 5'taactttggatgatgctactgcactccat3' was designed according to the obtained gene fragment. The leaf RNA of Upland cotton 7124 was extracted by thermal CTAB method. Referring to the instructions of the 3'RACE (TaKaRa, Japan) kit, using 3 Sites Adaptor Primer (5'ctgatctagaggtaccggatcc3') and p-F2 as primers, using the cDNA obtained by reverse transcription of cotton leaf RNA as a template, PCR amplification was performed to obtain Gh- npr1 3' end product. PCR reaction conditions were: denaturation at 94°C for 5 min; 30 cycles of 94°C for 30s, 66°C for 30s, 72°C for 2 min; extension at 72°C for 5 min. The obtained target fragment was cloned into pMD18-T vector, transformed into DH5α by heat shock method, screened and identified positive clones, and sequenced the positive clones to obtain the 3'-end sequence of the gene.

[0061] 1.2.3 Obtaining the 5' end of Gh-npr1 gene cDNA

[0062] The primers p-R2: 5'tgccttcaccatcagagagagact3' and p-R3: 5'acagtggaaagcaaccacgaggat3' were designed and synthesized according to the obtained gene sequence, according to GeneRacer TM RACE Ready cDNA Kit (Invitrogen, USA) instructions, first dephosphorylate and decap leaf RNA, and then add GeneRacer to the 5' end TM RNAOligo, utilizing SuperScirpt TM Reverse transcriptase, using oligo dT as primer for reverse transcription, and finally using 5'RACE primer (5'cgactggagcacgaggacactga3') and p-R2 (5'tgccttcaccatcagagagagact3'), nested primer (5'ggacactgacatggactgaaggagta 3') and p-R2 -R3 (5'acagtggaaagcaaccacgaggat 3') was subjected to nested PCR to obtain the 5' end product. PCR reaction conditions were: denaturation at 94°C for 4 min; 30 cycles of 45s at 94°C, 1 min at 64°C, 1.5 min at 72°C; and extension at 72°C for 5 min. The product obtained by RACE was connected to pMD18T-Vector (TaKaRa, Japan), and the positive clones were screened and identified, and the sequence was determined to obtain the 5'-end sequence of the gene.

[0063] 1.2.4 Obtaining the full-length cDNA of Gh-npr1 gene

[0064] The full-length cDNA of Gh-npr1 was obtained by analyzing and assembling the 5' and 3' sequences with DNAMAN software.

[0065] Example 2 Construction of plant expression vector

[0066] According to the obtained upland cotton npr1 cDNA sequence, primers p-F3 (5'ggcctcgagatggcttatttgtctgagccatcatct 3') and p-R4 (5'cgtctcgagtcacaatttcctatacttgtagg 3') were designed respectively. For the convenience of vector construction, Xho I restriction sites were introduced at the 5' end of p-F3 and the 3' end of p-R4. The first-strand cDNA obtained by reverse transcription of leaf RNA was used as a template for PCR amplification. The reaction conditions were: denaturation at 94 °C for 4 min; 30 cycles of 94 °C for 45 s, 62 °C for 45 s, 72 °C for 1.5 min; extension at 72 °C for 5 min. The target gene fragment was ligated into pMD18-T-Vector to obtain pMD-npr1. The pMD-npr1 plasmid was digested with Xho I, and the Gh-npr1 gene fragment was recovered for future use. The pBI121 and pTΩ4A were digested with EcoRI/Hind III, and the 12kb and 1.4kb bands were recovered, respectively, and ligated to form the intermediate vector pB4A. This intermediate vector was digested with Xho I, and a 13.4kb band was recovered, which was recombined with the Gh-npr1 fragment to form a plant expression vector pF-npr1. The Gh-npr1 gene is driven by the CaMV 35S promoter with two enhancers and a poly(A) at the 3' end n tail and NOS terminator ( figure 1 ).

[0067] Example 3 Agrobacterium-mediated method to obtain bivalent transgenic tobacco

[0068] In this example, the transgenic tobacco with Gh-npr1 gene was successfully obtained by Agrobacterium-mediated method.

[0069] The tobacco receptor material used is NC89, and the Agrobacterium is LBA4404. The specific operation steps are as follows:

[0070] 1) Preparation of Agrobacterium tumefaciens LBA4404 competent

[0071] (1) Pick a single colony from the plate, inoculate it into 5ml YEB liquid medium (containing streptomycin Strep 125mg/L), and shake it at 28°C and 250rpm overnight;

[0072] (2) Take 2ml of bacterial liquid, add 50ml of YEB liquid medium (containing Strep 125mg/L), and shake to OD at 28°C and 250rpm. 600 about 0.6;

[0073] (3) Transfer the bacterial solution to a 50ml sterile centrifuge tube and take an ice bath for 30min. Centrifuge at 5000rpm for 5min;

[0074] (4) Discard the supernatant and precipitate with 2ml of 20mM CaCl 2 Resuspend and dispense 100 μl each into 1.5 ml centrifuge tubes and store in liquid nitrogen for later use.

[0075] 2) Transfer the recombinant plasmid DNA into Agrobacterium

[0076] (1) About 1 μg of p2301GAT, p2301G2 and p2301G2-gat plasmid DNA were added to 100 μl of LBA4404 competent cells, mixed well, and ice-bathed for 5 minutes;

[0077] (2) Freeze the centrifuge tube in liquid nitrogen for 8min, and quickly transfer to a 37°C water bath for 5min;

[0078] (3) Add 1 ml of YEB liquid medium, and revive for 4-5 hours on a shaker at 28°C at 250 rpm;

[0079] (4) Apply an appropriate amount of bacterial liquid to YEB solid medium containing Strep 250-300mg/L, Rif (rifampicin) 250-300mg/L and Kan (kanamycin) 100mg/L, and culture at 28°C 24-48h.

[0080] 3) Transformation of tobacco variety NC89 by leaf disk method

[0081] (1) Activation of Agrobacterium

[0082] Pick a single colony of Agrobacterium from the plate, inoculate it into 5ml YEB liquid medium (Kan 100mg/L, Strep 100mg/L, Rif 300mg/L), shake and cultivate overnight; Kan100mg/L, Strep 100mg/L, Rif 300mg/L), vigorously shake and culture to OD 600 0.4-0.5 (about 3-4h); centrifuge at 5,000rpm for 5min, and use MS 0 Medium (without hormones) resuspended to make OD 600 is 0.1-0.2;

[0083] (2) Genetic transformation of tobacco

[0084] a) Co-cultivation: The infected leaves were placed on the tobacco bud differentiation medium (MS+IAA 0.5mg/L+6-BA 2mg/L) covered with 2 layers of filter paper, and cultured at 25°C for 4 days in the dark ;

[0085] b) Screening of resistant buds: The co-cultivated tobacco explants were transferred to resistant bud selection medium (MS+IAA 0.5mg/L+6-BA 2mg/L+Kan 100mg/L+Cef (Thiospora spp. Mycin) 500mg/L), buds can be formed after 2 to 3 weeks;

[0086] Rooting: When the resistant shoots grow to about 1cm, transfer them to rooting medium (MS+Kan 100mg/L+Cef 500mg/L), and adventitious roots will form after 1-2 weeks.