Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Upland cotton disease-resistant gene and use thereof

A disease-resistant, transgenic plant technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of undeveloped upland cotton disease resistance gene npr1 and other problems, and achieve the effect of improving disease resistance and broad application prospects.

Inactive Publication Date: 2009-04-29
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, there is no report on the development of the upland cotton disease resistance gene npr1 in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Upland cotton disease-resistant gene and use thereof
  • Upland cotton disease-resistant gene and use thereof
  • Upland cotton disease-resistant gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 Cloning of Gh-npr1 gene

[0058] 1.2.1 Cloning of Gh-npr1 gene fragment

[0059]Cotton DNA was extracted by the improved CTAB method, and a degenerate primer p-F1(5'agg cac(t)tt(g)g ac(t)t cng atg ata(g)tt( a)g a3'), p-R1(5'tcc(t)c(t)tc(a,t)cg(t)ca ata(c)gcagca at(c)g(a)tga ag3'), Gene fragments were amplified by Touch-Down PCR. The PCR reaction conditions were: denaturation at 94°C for 5min; 2 cycles of 94°C for 30sec, 60°C for 30sec, and 72°C for 1min; 2 cycles of 94°C for 30sec, 58°C for 30sec, and 72°C for 1min; 94°C for 30sec, 56°C for 30sec, 72°C 1min, 2 cycles; 94°C 30sec, 54°C 30sec, 72°C 1min, 2 cycles; 94°C 30sec, 52°C 30sec, 72°C 1min, 30 cycles; 72°C extension 5min. 1.2.2 Obtaining the 3' end of cDNA of Gh-npr1 gene.

[0060] A specific primer F2 was designed according to the obtained gene fragment: 5'taactttggatgatgctactgcactccat3'. The leaf RNA of upland cotton 7124 was extracted by thermal CTAB method. Referring to the 3'RACE (TaKaRa, Japa...

Embodiment 2

[0065] Example 2 Construction of Plant Expression Vectors

[0066] According to the obtained upland cotton npr1 cDNA sequence, primers p-F3 (5'ggcctcgagatggcttatttgtctgagccatcatct 3') and p-R4 (5'cgtctcgagtcacaatttcctatacttgtagg 3') were designed respectively. For the convenience of vector construction, Xho I restriction sites were introduced at the 5' end of p-F3 and the 3' end of p-R4. The first-strand cDNA obtained by reverse transcription of leaf RNA was used as a template for PCR amplification. The reaction conditions were: denaturation at 94°C for 4 min; 30 cycles of 45 s at 94°C, 45 s at 62°C, and 1.5 min at 72°C; extension at 72°C for 5 min. The target gene fragment was ligated into pMD18-T-Vector to obtain pMD-npr1, the pMD-npr1 plasmid was digested with Xho I, and the Gh-npr1 gene fragment was recovered for future use. Digest pBI121 and pTΩ4A with EcoRI / Hind III, recover 12kb and 1.4kb bands respectively, and construct the intermediate vector pB4A after ligation. T...

Embodiment 3

[0067] Example 3 Agrobacterium-mediated method to obtain bivalent transgenic tobacco

[0068] In this example, the transgenic tobacco with the Gh-npr1 gene was successfully obtained by using the Agrobacterium-mediated method.

[0069] The tobacco receptor material used is NC89, and the Agrobacterium is LBA4404. The specific operation steps are as follows:

[0070] 1) Preparation of competent Agrobacterium tumefaciens LBA4404

[0071] (1) Pick a single colony from the plate, inoculate it into 5ml YEB liquid medium (containing Streptomycin Strep 125mg / L), and culture overnight at 28°C and 250rpm with shaking;

[0072] (2) Take 2ml of bacterial liquid, add it into 50ml of YEB liquid medium (containing Strep125mg / L), shake and cultivate to OD at 28°C and 250rpm 600 About 0.6 or so;

[0073] (3) Transfer the bacterial solution to a 50ml sterile centrifuge tube and place in an ice bath for 30min. Centrifuge at 5000rpm for 5min;

[0074] (4) Discard the supernatant and use 2ml o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a disease-resistant gene of upland cotton and application of the disease-resistant gene in cultivating a disease-resistant transgenic plant. The invention initially discovers an npr1 gene which can improve the disease resistance of the plant, constructs a constitutive expression type plant expression vector containing the gene and converts the plant expression vector into a plant cell. Experiments prove that after the gene is expressed in the plant, the obtained transgenic plant remarkably improves the capacity for resisting pathogenicbacteria.

Description

Technical field: [0001] The invention relates to an upland cotton disease-resistant gene and its application in breeding disease-resistant transgenic plants. The present invention also relates to a construct comprising the gene, a recombinant expression vector containing the construct, a plant cell transformed by the expression vector, and a transgenic plant produced by the transformed cell showing high resistance to pathogenic bacteria. Background technique [0002] The use of chemical pesticides to prevent and control plant diseases will cause environmental pollution problems, and pathogenic bacteria will develop drug resistance. Genetic engineering is a new way to improve the disease resistance of plants. [0003] During the long-term co-evolution process with pathogens, plants have formed intricate defense mechanisms to resist the infection of pathogens. In the incompatibility interaction mode, the plant's disease resistance gene (resistant gene, R gene) recognizes a s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H1/00
Inventor 王旭静王志兴贾士荣唐巧玲
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com