Anti-herbicide gene and use thereof

A herbicide-resistant gene and herbicide technology, applied in the field of genetic engineering, can solve the problems of unstable gene expression products and low expression abundance of a single gene, reduce food and ecological risks, simplify weed control methods, and expand application. range effect

Inactive Publication Date: 2009-06-10
ZHEJIANG UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of traditional reverse genetics methods including EMS mutagenesis, T-DNA and transposon insertion, etc., as well as gene overexpression technology, gene chip technology and antisense RNA or RNAi inhibition technology to study the biological functions of such genes often Hindered by the existence of a large number of intricately homologous sequences between different genes, the low abundance of individual genes expressed, and the instability of gene expression products in extracts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-herbicide gene and use thereof
  • Anti-herbicide gene and use thereof
  • Anti-herbicide gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1, the selection of the corn product system sensitive to nisulfuron corn

[0038] Collect 10 different corn varieties and spray nisulfuron (g active ingredient / mu) at the 5-6 leaf stage. One of the varieties, N-SS, is sensitive to nisulfuron, and it can kill 100% by spraying 5g / mu of active ingredient once. The offspring of N-SS crossed with two resistant varieties D001 and D002 were still resistant. N-SS, D001 and D002 are all provided by Zhejiang University College of Agriculture and Biotechnology (can be obtained by purchasing).

Embodiment 2

[0039] Example 2 Cloning and comparison of P450 genes in niasulfuron-sensitive maize and nisulfuron-resistant maize

[0040] According to the sequence of the maize genome database, 5 pairs of PCR primers were designed to amplify 5 P450 genes that may be involved in resistance to nibasulfuron from the resistant line D001 and the sensitive line N-SS, respectively.

[0041] The primers for PCR are:

[0042] Gene 1:

[0043] Azm-1-F: GGATCCACCATGGATAAGGCCTACATCGCCGCCC;

[0044] Azm-1-R: TCTAGATTCAGAGCCTCTTAAGAACACCACGC;

[0045] Gene 2:

[0046] Azm-2-F: GGATCCACCATGGATAAGGCCTACGTGGCCGTG;

[0047] Azm2-6R: TCTAGATTCAGAGCTCCAGAAGAAGATGGCGC;

[0048] Gene 3:

[0049] Azm-3-F: AGATCTACCATGGATCTGGCGGCCTACATCGCCA;

[0050] AZM-3-R: TCTAGATCATATCTTCTGAAGAACGTCATAC;

[0051] Gene 4:

[0052] Azm-4-F: GGATCCACCATGGACGACAAGTCCTGCTACGTGG;

[0053] Azm-4-R: TCTAGATCAGAGCTGCTGAAGAACATGACGC;

[0054] Gene 5:

[0055] Azm-5-F: GGATCCAACAATGGATAAGGCCTATGTCGCCG;

[0056] Azm-5-R: GGT...

Embodiment 3

[0059] Embodiment 3, the construction of the transformation vector of corn P450 gene transfection rice

[0060] In order to further prove the functions of the maize P450 genes obtained from the resistant variety D001 in Example 2, the expression cassettes of these genes were constructed in plant transformation vectors, and then transformed into rice for expression to study their functions. The promoter controlling the expression of the maize P450 gene in the expression frame is the maize ubiquitin (Ubiqutin-1) promoter. It was amplified from the maize genome by PCR, and the primer used was ZmUbiF (GCG AAGCTT GCATGCCTACAGTGCAGCGTGACCCGGTCGTGC, (the underline is the HindIII site) and ZmUbiR (GTG GGATCC TCTAGAGTCGACCTGCAGAAGTAACACCAAACAACAG, (the underline is the BmHI site). Maize P450 genes and their terminators were obtained directly from the genome by PCR (Example 2).

[0061] Five transformed T-DNA vectors pCAMB1300Rice-G6-zm1 / 2 / 3 / 4 / 5 were constructed using the vector pCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a herbicide-resistant gene, wherein a nucleotide sequence of the gene is SEQ ID NO: 1 or has more than 90 percent of identity with the SEQ ID NO: 1. The invention also discloses herbicide-resistant protein encoded by the herbicide-resistant gene, wherein an amino acid sequence of the protein is SEQ ID NO: 2 or has more than 90 percent of identity with the SEQ ID NO: 2. The gene can be used for preparing a transgenic plant which increases the resistance to a herbicide, or obtaining a method which utilizes the herbicide to selectively kill transgenic corn.

Description

technical field [0001] The invention belongs to the field of genetic engineering, specifically, the invention relates to a gene and the use of the gene to produce transgenic crops capable of resisting at least one herbicide and the use of the gene to produce a gene that can be selectively killed by at least one herbicide method of genetically modified maize. Background technique [0002] Weed control is an important issue in crop cultivation. The use of herbicides to kill weeds is a relatively simple and economical method. But herbicides often cannot selectively kill weeds, especially those that are closely related to crops. Therefore, the use of herbicides has been greatly restricted. The use of genetically modified methods to develop herbicide-resistant crops can remove this limitation, thereby making better use of herbicides to control weeds. [0003] The herbicide-resistant gene can be introduced into crops by means of transgenic methods, so that the crops can obtain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/63C12N5/10A01H5/00
Inventor沈志成林朝阳徐晓丽方军
OwnerZHEJIANG UNIV