Detection kit for Mycoplasma hyopneumoniae and use thereof
A Mycoplasma hyopneumoniae, one-to-one technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, microorganisms, etc., can solve the problems of expensive preparation of fluorescent probes, unsuitable for grassroots applications, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1, the preparation of Mycoplasma hyopneumoniae detection kit
[0061] 1. Synthesis of primers
[0062] Artificially synthesize the following 3 pairs of primers:
[0063] F3: AACATCTCACGACACGAG;
[0064] B3: GCTAACGCGTTAAATGATCC;
[0065] FIP: CTTACCCACTCTTGACATTCTCGTTTTCGACAACCATGCACCATC;
[0066] BIP: TAAACCACATGCTCCACCGCTTTTGCCTGAGTAGTATGCTCG;
[0067] LF:AGAGATATAGCCGAGGCTAACGAG;
[0068] LB: TGTGCGGGTTCCCGTCA.
[0069] 2. Preparation of sample tube
[0070] A small disc with a diameter of 2.0 mm was removed from a blank FTA card (Whatman, Cat No. WB120205) with a 2.0 mm perforated sampler, and placed at the bottom of a 0.25 ml centrifuge tube.
[0071] 3. Preparation of positive control
[0072] The 232 strains of Mycoplasma hyopneumoniae (China Veterinary Drug Administration) were diluted with normal saline and inoculated into healthy pigs. Two weeks later, the diseased lung was collected with aseptic technique, and the pathogen was isolated and...
Embodiment 2
[0077] Embodiment 2, the preparation of Mycoplasma hyopneumoniae detection kit
[0078] 1. Synthesis of primers
[0079] Same as Step 1 of Example 1.
[0080] 2. Preparation of sample tube
[0081] Same as Step 2 of Example 1.
[0082] 3. Preparation of positive control
[0083] Same as Step 3 of Example 1.
[0084] 4. Preparation of LAMP reaction solution
[0085] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , 0.025 μL Tween20, 20 μmol MgSO 4, 20μmol betaine (Betaine), 0.00125μmol calcein, 0.015μmol MnCl 2 , four deoxynucleotides (dNTPs) each 0.035umol, 0.06μmol upstream inner primer (FIP), 0.06μmol downstream inner primer (BIP), 0.008μmol upstream outer primer (F3), 0.008μmol downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 8 U of Bst DNA polymerase, sterile double distilled water.
[0086] 5. Assembling the kit
[00...
Embodiment 3
[0088] Embodiment 3, the preparation of Mycoplasma hyopneumoniae detection kit
[0089] 1. Synthesis of primers
[0090] Same as Step 1 of Example 1.
[0091] 2. Preparation of sample tube
[0092] Same as Step 2 of Example 1.
[0093] 3. Preparation of positive control
[0094] Same as Step 3 of Example 1.
[0095] 4. Preparation of LAMP reaction solution
[0096] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , 0.025 μL Tween20, 10 μmol MgSO 4 , 20μmol betaine (Betaine), 0.00125μmol calcein, 0.015μmol MnCl 2 , four deoxynucleotides (dNTPs) each 0.035umol, 0.05μmol upstream inner primer (FIP), 0.05μmol downstream inner primer (BIP), 0.006μmol upstream outer primer (F3), 0.006μmol downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 8 U of Bst DNA polymerase, sterile double distilled water.
[0097] 5. Assembling the kit
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
