Unlock instant, AI-driven research and patent intelligence for your innovation.

Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression

A Chinese mitten crab gene technology, applied in genetic engineering, plant genetic improvement, food preservation, etc., can solve the problems of breeding industry losses, serious diseases, etc.

Inactive Publication Date: 2009-09-09
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous expansion of the scale of Chinese mitten crab farming, various diseases are becoming more and more serious, causing huge losses to the farming industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] A cloned Chinese mitten crab Crustin-1 has the sequence shown in SEQ ID NO.1. The cDNA sequence cloning of Chinese mitten crab Crustin-1 among the present invention comprises the following steps:

[0013] a) Extraction of total RNA of Eriocheir sinensis and purification of mRNA;

[0014] b) Construction of cDNA library of Chinese mitten crab;

[0015] c) Large-scale determination of the EST sequence of the Chinese mitten crab cDNA library;

[0016] d) Homology analysis of EST sequence of Chinese mitten crab and screening of Crustin-1 gene fragment;

[0017] e) EST sequence splicing to obtain the full sequence of Crustin-1;

[0018] f) In vitro recombinant expression and activity analysis of Chinese mitten crab Crustin-1.

[0019] The specific operation is as follows:

[0020] 1. Extraction of total RNA from Chinese mitten crab and purification of mRNA: use Trizol reagent from Invitrogen to extract total RNA from the hemolymph of mitten crab infected with Vibrio ang...

Embodiment 2

[0060] According to the cDNA sequence corresponding to SEQ ID NO.2, specific primers F2 (5'CATATGTGTCGATACTGGTGCAAGA 3') and R2 (5'CTCGAGTTAGTGGTGGTGGTGGTGGTGACCCTTGGTCTGGATTGGCTTGCAG 3') containing restriction endonuclease Nde I and Xho I restriction sites were designed. The gene fragment encoding the mature peptide of Crustin-1 was amplified by PCR technology, and the reaction was carried out in a PTC-100 Programmable Thermal Controller cycler (MJ Research). The reaction conditions were: 94°C pre-denaturation for 5 minutes; then 35 cycles including 94°C denaturation for 30 minutes. seconds, anneal at 60°C for 30 seconds, extend at 72°C for 30 seconds; and finally extend at 72°C for 10 minutes. Then it was cloned into the pET30 expression vector, transformed into Escherichia coli origami (DE3), and after sequencing confirmed that the expression frame was correct, the positive clone was inoculated into LB medium, and cultured with shaking at 37°C until O.D. 600 = 0.4-0.6, add ...

Embodiment 3

[0061] Implementation example 3: Recombinant protein can lay the foundation for disease control, gene-assisted breeding and feed additive development of Chinese mitten crab.

[0062] Chinese mitten crab Crustin-1 gene and its recombinant expression in vitro.txt

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology, in particular to eriocheir sinensis Crustin-1 gene clone and a recombination expression technology thereof. Crustin-1 gene of which the cDNA span is 821bp is cloned from eriocheir sinensis by using an expressed sequence tag (EST) technology and a 3' and 5' end rapid augmentation technology (RACE) and comprises a 315bp open reading frame, polyadenylic acid tailing signals and polyadenylic acid tails, 104 amino acids are coded, the length of a 5' non-coding region is 239bp, the length of a 3' non-coding region is 267bp, and the Crustin-1gene play an important role in the immune defense aspect of the eriocheir sinensis. The invention obtains eriocheir sinensis Crustin-1 protein by using the in-vitro recombination expression technology, the recombination protein has stronger bacteriostatic activity for gram-positive bacteria, the minimal inhibitory concentrations of the recombination protein for micrococcus luteus, bacillus subtilis, micrococcus tetragenus and bacillus thuringiensis are 0.12 mu m, 0.23 mu m, 0.46 mu m and 0.12 mu m respectively, and the recombination protein does not have obvious inhibiting function. The invention can lay the foundation for the disease control of the eriocheir sinensis, the gene assistant breeding and the development of feed additives.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to the gene sequence of Chinese mitten crab Crustin-1, specifically screens an EST sequence related to Chinese mitten crab Crustin-1 from a cDNA library of Chinese mitten crab, and splices it into a complete sequence , and performed prokaryotic recombinant expression, and also involved the application of the gene and its expression products in the production of medicines, feed additives, preservatives and fresh-keeping agents. Background technique [0002] Antimicrobial peptides are amphipathic small molecular basic polypeptides that widely exist in the biological world, and are key factors in the body's innate immunity. Since Steiner discovered Cecropin, a total of more than 800 antimicrobial peptides have been found in various organisms so far. According to the sequence, secondary structure and antibacterial properties of antimicrobial peptides, the discovered antimicrobi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435A61K38/17A61P31/04A23K1/16A23L3/3526A23K20/195
Inventor 宋林生郑沛林母昌考赵建民王玲玲邱丽梅盖云超
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More