Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression
A Chinese mitten crab gene technology, applied in genetic engineering, plant genetic improvement, food preservation, etc., can solve the problems of breeding industry losses, serious diseases, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0012] A cloned Chinese mitten crab Crustin-1 has the sequence shown in SEQ ID NO.1. The cDNA sequence cloning of Chinese mitten crab Crustin-1 among the present invention comprises the following steps:
[0013] a) Extraction of total RNA of Eriocheir sinensis and purification of mRNA;
[0014] b) Construction of cDNA library of Chinese mitten crab;
[0015] c) Large-scale determination of the EST sequence of the Chinese mitten crab cDNA library;
[0016] d) Homology analysis of EST sequence of Chinese mitten crab and screening of Crustin-1 gene fragment;
[0017] e) EST sequence splicing to obtain the full sequence of Crustin-1;
[0018] f) In vitro recombinant expression and activity analysis of Chinese mitten crab Crustin-1.
[0019] The specific operation is as follows:
[0020] 1. Extraction of total RNA from Chinese mitten crab and purification of mRNA: use Trizol reagent from Invitrogen to extract total RNA from the hemolymph of mitten crab infected with Vibrio ang...
Embodiment 2
[0060] According to the cDNA sequence corresponding to SEQ ID NO.2, specific primers F2 (5'CATATGTGTCGATACTGGTGCAAGA 3') and R2 (5'CTCGAGTTAGTGGTGGTGGTGGTGGTGACCCTTGGTCTGGATTGGCTTGCAG 3') containing restriction endonuclease Nde I and Xho I restriction sites were designed. The gene fragment encoding the mature peptide of Crustin-1 was amplified by PCR technology, and the reaction was carried out in a PTC-100 Programmable Thermal Controller cycler (MJ Research). The reaction conditions were: 94°C pre-denaturation for 5 minutes; then 35 cycles including 94°C denaturation for 30 minutes. seconds, anneal at 60°C for 30 seconds, extend at 72°C for 30 seconds; and finally extend at 72°C for 10 minutes. Then it was cloned into the pET30 expression vector, transformed into Escherichia coli origami (DE3), and after sequencing confirmed that the expression frame was correct, the positive clone was inoculated into LB medium, and cultured with shaking at 37°C until O.D. 600 = 0.4-0.6, add ...
Embodiment 3
[0061] Implementation example 3: Recombinant protein can lay the foundation for disease control, gene-assisted breeding and feed additive development of Chinese mitten crab.
[0062] Chinese mitten crab Crustin-1 gene and its recombinant expression in vitro.txt
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com