Improved gene construction method and property testing of fast-acting insulin precursor
A technology of insulin precursor and insulin, applied in the fields of biotechnology and pharmacy, can solve the problem of low expression of the precursor
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] Construction of plasmid pPIC9K / GEMIP
[0094] Synthesize the insulin analogue gene fragment GEMIP (Monomeric insulinprecursor) by chemical synthesis, according to the codon preference of P. pastoris (strain GS115, purchased from Invitrogen), chemically synthesize the monomeric insulin precursor (GEMIP) gene fragment :
[0095] 5-gaattcaagttcgtcaaccaacacttgtgtggttcccacttggtcgaggctttgtacttggtctgtggtgaaa
[0096] gaggtttcttctacaagggtgaaagaggtttcttctacacccctgctgctaagggtatcgtcgaacaatgttgta
[0097] cctccatctgctccttgtaccaattggagaactactgtaactaggcggccgc-3 (SEQ ID NO: 2).
[0098] Appropriate prepro-leader helps the secretory expression of insulin precursor in P. pastoris. The chemically synthesized DNA fragment is cloned into the EcoRI and NotI sites of the pPIC9K plasmid to form the α-Mating factor leader-EAEAYVEFK-GEMIP expression framework. Among them, the spacer peptide rich in EA is beneficial to the secretion of insulin precursor. GEMIP is the precursor of DTI, and its structure ...
Embodiment 2
[0112] Electrotransformation of Methanol Yeast and Screening of High-Expression Clones
[0113] Plasmids pPIC9K / GEMIP, pPIC9K / MIP, and pPIC9K / PIP were respectively linearized by Bgl II digestion. The digestion reaction solution was extracted with phenol and chloroform, precipitated with ethanol, and dissolved in 1 mol / L sorbitol before being transformed. After the linearized plasmid enters the yeast cell, it is partially recircularized and inserted into the chromosome at a single point to obtain Mut + Phenotypic transformant, the other part is integrated into the chromosome by linear substitution to obtain Mut s Phenotypic transformants will spontaneously form multi-copy insertion integration during this process.
[0114] The pPIC9K / GEMIP plasmid carries an anti-G418 gene, and the copy number of the plasmid is proportional to the G418 (0~4mg / ml) resistance of the transformant. The inventors selected clones on the 4mg / ml G418 YPD plate for expression experiments.
Embodiment 3
[0116] Test tube expression comparison results of MIP, PIP, GEMIP expression
[0117] Inoculate the strains containing 3 kinds of target precursors into test tubes for culture, then receive 2ml YPD test tube culture medium, culture at 30℃ shaker 260r / min for 2 days, centrifuge at 4℃ 3000r / min for 5min, discard the supernatant and use fresh Resuspend the bacteria in 2ml YP medium (without glucose), transfer to a new test tube, add 20μl methanol every day for induction, induce 72h, centrifuge to take the supernatant and concentrate 10 times and load the sample for native electrophoresis identification, see figure 2 .
[0118] According to the electrophoresis diagram, the photoshop analysis software can roughly get the test tube expression levels MIP, PIP, GEMIP are 39μg / ml, 150μg / ml, 80μg / ml, see image 3 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
