Improved gene construction method and property testing of fast-acting insulin precursor
A technology of insulin precursor and insulin, which is applied in the fields of biotechnology and pharmacy, and can solve the problem of low precursor expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] Construction of plasmid pPIC9K / GEMIP
[0094] The insulin analog gene fragment GEMIP (Monomeric insulinprecursor) was synthesized by chemical synthesis, and the monomeric insulin precursor (GEMIP) gene fragment was chemically synthesized according to the codon preference of methanol yeast P. pastoris (strain GS115, purchased from Invitrogen Company) :
[0095] 5-gaattcaagttcgtcaaccaacacttgtgtggttcccacttggtcgaggctttgtacttggtctgtggtgaaa
[0096] gaggtttcttctacaagggtgaaagaggtttcttctacacccctgctgctaagggtatcgtcgaacaatgttgta
[0097] cctccatctgctccttgtaccaattggagaactactgtaactaggcggccgc-3 (SEQ ID NO: 2).
[0098] A suitable prepro-leader is helpful for the secretion and expression of insulin precursor in P. pastoris. The chemically synthesized DNA fragment was cloned into the EcoRI and NotI sites of the pPIC9K plasmid to form the α-Mating factorleader-EAEAYVEFK-GEMIP expression framework. Among them, the spacer peptide rich in EA is beneficial to the secretion of insulin pre...
Embodiment 2
[0112] Electrotransformation of Methanol Yeast and Screening of High Expression Clones
[0113] The pPIC9K / GEMIP, pPIC9K / MIP, and pPIC9K / PIP plasmids were linearized by Bgl II enzyme digestion, respectively, and the enzyme digestion reaction solution was extracted with phenol and chloroform, and dissolved in 1mol / L sorbitol after ethanol precipitation, to be transformed. After the linearized plasmid enters the yeast cell, it is partially re-circularized and inserted into the chromosome at a single point to obtain Mut + Phenotype transformants, the other part is integrated into the chromosome by linear substitution, resulting in Mut s Phenotypic transformants, during which multicopy insertion integrations spontaneously form.
[0114] The pPIC9K / GEMIP plasmid carries the anti-G418 gene, and the copy number of the plasmid is directly proportional to the G418 (0-4mg / ml) resistance of the transformant. The inventors selected the clones on the 4mg / ml G418 YPD plate for expression ...
Embodiment 3
[0116] Test tube expression comparison of expression results of MIP, PIP, GEMIP
[0117] Inoculate the strains containing the 3 target precursors into test tubes for culture, transfer them to 2ml YPD test tube culture medium, culture on a shaker at 260r / min at 30°C for 2 days, centrifuge at 3000r / min at 4°C for 5min, discard the supernatant, and use fresh Resuspend the bacteria in 2ml of YP medium (without glucose), transfer them into a new test tube, add 20μl of methanol every day for induction, and induce for 72 hours, centrifuge to get the supernatant concentrated 10 times, load the sample for native electrophoresis identification, see figure 2 .
[0118] According to the electropherogram, the expression levels of MIP, PIP, and GEMIP in test tubes can be roughly obtained by using photoshop analysis software, which are 39 μg / ml, 150 μg / ml, and 80 μg / ml, respectively, see image 3 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
