Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof
A repetitive sequence and dynamic technology, applied in the field of biomedicine, can solve the problem of low specificity of ATXN3 gene CAG repeat sequence, and achieve the effect of high PCR efficiency and sensitivity, simple operation and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: A primer for detecting the dynamic mutation of the CAG repeat sequence of the spinocerebellar ataxia ATXN3 gene, using the following pair of primers (5'→3'):
[0039] Forward primer: CCAGTGACTACTTTGATTCG;
[0040] Reverse primer: CATGATGAATGGTGAGCAGG.
[0041] In this embodiment, the dynamic mutation of the CAG repeat sequence of the ATXN3 gene in spinocerebellar ataxia can be detected by the above pair of primers.
Embodiment 2
[0042] Embodiment 2: A PCR amplification method for detecting the dynamic mutation of the CAG repeat sequence of the spinocerebellar ataxia ATXN3 gene, comprising the following steps:
[0043] Step 1: Prepare DNA
[0044] (1) Blood samples are drawn from the human body.
[0045] (2) Obtaining DNA from blood samples, that is, preparation of genomic DNA samples of leukocytes in blood samples.
[0046] Reagent preparation:
[0047] Anticoagulant: Each 100ml anticoagulant contains 0.48g citric acid, 1.32g sodium citrate, and 1.47g glucose.
[0048] Red blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;
[0049] 5mmol / L MgCl 2 ;
[0050] 10mmol / L NaCl;
[0051] White blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;
[0052] 10mmol / L EDTA (pH 8.0)
[0053] 50mmol / L NaCl
[0054] 10mg / ml proteinase K (Protease K): 10mg Protease K dissolved in 1ml ddH 2 O (double distilled water), aliquoted and stored at -20°C. When in use, melt...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com