Cell-penetrating peptide (Arg) 9 and lidamycin fusion protein (Arg) 9-LDP

A 9-LDP-AE, fusion protein technology, applied in the direction of peptide/protein components, DNA/RNA fragments, peptides, etc., to achieve the effect of inhibiting tumor growth, good clinical application prospects, and promoting tumor cell apoptosis

Inactive Publication Date: 2010-10-06
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In previous studies, polyarginine (Arg) was chemically 9 Coupling with protein, polyarginine (Arg) 9 Form a fusion protein with a protein, so far there is no related report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell-penetrating peptide (Arg) 9 and lidamycin fusion protein (Arg) 9-LDP
  • Cell-penetrating peptide (Arg) 9 and lidamycin fusion protein (Arg) 9-LDP
  • Cell-penetrating peptide (Arg) 9 and lidamycin fusion protein (Arg) 9-LDP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0146] . Fusion protein (Arg) 9 -LDP recombinant expression plasmid pET30-(arg) 9 build of ldp

[0147] The recombinant plasmid pET30-vhldp (patent: CN200410034052.7) contains the LDP gene. Two restriction sites, NdeI and XhoI, were introduced by PCR (primers were synthesized by Invitrogen).

[0148] Upstream primer: 5′GAATTC CATATG GGCGCGCCCGCCTTCTCCGT 3′(The underlined part is the Nde I restriction site, and the italic part is (arg) 9 Gene)

[0149] Downstream primer: 5′GTTA CTCGAG GCCGAAGGTCAGAGCCACGTG3′ (the underlined part is the Xho I restriction site)

[0150] Recombinant expression plasmid pET30-(arg) 9 The construction process of ldp is as follows figure 1 shown. Carry out PCR amplification with recombinant plasmid pET30-vhldp as template, obtain (arg) 9 ldp gene fragment ( figure 2 ). The PCR reaction system was denaturation at 94°C for 5 minutes, followed by 30 cycles of amplification reaction: denaturation at 94°C for 1 minute, annealing at 58°C fo...

Embodiment 2

[0151] . Fusion protein (Arg) 9 -LDP in Escherichia coli BL21(DE3) star TM inducible expression

[0152] identified pET30-(arg) 9 Transformation of ldp recombinant plasmid into Escherichia coli BL21(DE3)star TM (Invitrogen company product), randomly pick recombinant transformants and inoculate into 3 ml LB liquid medium containing 50 μg / ml kanamycin, and culture overnight at 37° C. with shaking. The next day, they were inoculated at a ratio of 5%, cultured with shaking at 37°C until the OD600 was 0.8, added IPTG to a final concentration of 0.2mM, and induced for 8 hours. Take an appropriate amount of bacterial liquid, and analyze the expression product localization of the whole bacteria, culture supernatant, periplasmic cavity fraction, soluble cytoplasmic fraction and inclusion body fraction. The results of 15% SDS-PAGE electrophoresis and immunoblotting showed that the fusion protein with a molecular weight of about 14.5kDa was expressed in inclusion bodies in an insolub...

Embodiment 3

[0153] . Fusion protein (Arg) 9 -LDP affinity chromatography purification and separation preparation

[0154] 3.1 Extraction of inclusion body protein

[0155] The culture of recombinant bacteria induced by IPTG was centrifuged at 10000 g for 10 min, the supernatant was removed as much as possible, and the bacteria were collected. Resuspend the cells with 100ml of 20mM Tris-HCl per 1L of culture volume. Sonication disrupts cells. Centrifuge at 10,000 g at 4°C for 15 min to collect inclusion bodies and cell fragment proteins, and discard the supernatant. The pellet was resuspended with 100 ml of urea-free 1×Binding Buffer (20 mM Tris-HCl, 0.5 M NaCl, 5 mM imidazole, pH 8.0). Centrifuge at 10,000 g for 15 min at 4°C, discard the supernatant, and collect the precipitate. Repeat the above operation steps, resuspend the pellet with 50ml 1×Binding Buffer (20mM Tris-HCl, 0.5MNaCl, 5mM imidazole, 8M urea, pH8.0), and completely dissolve the inclusion body protein in ice bath for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to fusion protein (Arg)9-LDP and reinforced fusion protein (Arg)9-LDP-AE thereof. The fusion protein consists of cell-penetrating peptide (Arg)9, lidamycin apoprotein LDP and carboxyl terminal hexamerichistidine tail, wherein the full length of gene is 387bp, and 129 amino acids are encoded; the reinforced fusion protein is formed by fusion protein (Arg)9-LDP with molecular weight of about 14.5kDa and activated enediyne chromophore AE with molecular weight of 843Da; in-vivo and in-vitro experiment results prove that the fusion protein and reinforced fusion protein thereof have intense killing effect on glioma cells, and have remarkable curative effect in in-vivo animal experiments, and are expected to be developed into clinic efficient glioma treating medicament.

Description

Technical field: [0001] The present invention relates to a fusion protein (Arg) 9 - LDP, specifically, said fusion protein contains a cell penetrating peptide (Arg) 9 and the amino acid sequence of lidamycin prosthetic protein LDP; [0002] The present invention also relates to a strengthened fusion protein (Arg) containing an enediyne chromophore (AE) that can be prepared through molecular strengthening 9 -LDP-AE; [0003] The invention also relates to the application of said fusion protein and its strengthened fusion protein in tumor treatment. Background technique: [0004] Lidamycin (lidamycin, LDM, also known as C-1027), is a strain of Streptiomyces globisporus C-1027 isolated from the soil of Qianjiang County, Hubei Province, my country (preserved in CGMCC on April 3, 2007 , strain preservation number is: CGMCC No.0704) produced enediyne antibiotics, composed of two parts of enediyne chromophore (AE) and prosthetic protein (LDP) composed of 110 amino acid residues, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K1/22C07K1/107C12N15/62C12N15/70C12N1/21A61K38/16A61K47/48A61P35/00A61K47/42
Inventor茹琴甄永苏尚伯杨郑艳波苗庆芳
OwnerMEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI