Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting N gene-controlled tobacco TMV resistance by molecular markers

A marker detection and tobacco technology, applied in the biological field, can solve problems such as the success of inoculation with a large workload, and achieve the effects of fast detection, improved selection efficiency, and fast speed.

Active Publication Date: 2010-11-24
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional identification method mainly relies on the field identification method, which has a large workload and is directly related to the success of the experimenter's inoculation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting N gene-controlled tobacco TMV resistance by molecular markers
  • Method for detecting N gene-controlled tobacco TMV resistance by molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] (1) The partial nucleotide sequence of tobacco N gene is:

[0049] ( GGCATGACATCTCTGCTTCA GATTCCTTGTCACTAACAGTATTTACCGGTCAACCGTATCCTGAAAAGATCCCGAGTTGGTTCCACCATCAGGGTTGGGATAGTAGTGTATCAGTCAATTTGCCTGAAAATTGGTATATACCTGATAAATTCTTGGGATTTGCTGTATGTTACTCTCGTAGCTTAATTGACACAACAGCTCACTTGATTCCCGTATGTGATGACAAGATGTCGCGCATGACCCAGAAACTTGCCTTATCAGAATGTGATACAGAATCATCCAACTATTCAGAATGGGATATACATTTTTTCTTTGTACCTTTTGCTGGCTTATGGGATACATCTAAGGCAAATGGAAAAACACCAAATGATTATGGGATTATTAGGCTATCTTTTTCTGGAGAAGAGAAGATGTATGGACTTCGTTTGTTGTATAAAGAAGGACCAGAGGTTAATGCCTTGTTACAAATGAGGGAAAATAGCAATGAACCAACAGAACATTCCACTGGGATAAGGAGGACTCAATATAACAACAGAACTTCCTTTTATGTAAGTCTCTACTTCTATTAGCTACAAAGTCTTCTTCCAAAATCAATACTCCATCCGTTCCAGTTTATGTGAACCTATTTTTTGTTCGTCCATTCTAAAAAGAATGACCCCTTTCTAAATTTGGAAATAATTTTGGTTAAACTTATAATTCTACCATTAACGAGAAGCTTTTATAACCACACAAATATTCTGGGGCCCTTTTTGAATTGTTTAGGACCATAAATTCCAAAAGTCCTCATTTTTTCTTAAACTCCGTGCCCAATCAAACAAGTTCACGTAAATTGGAACGGAGGGAATATATTTTTTCTTCTCATTCTTTTCCCCTATTTACAGGAGCTCATCAATGGGTGATGTACATATCAACAAC...

Embodiment 2

[0057] (1) 84 flue-cured tobacco varieties (lines) were selected, and the resistance of these materials to TMV is shown in Table 1.

[0058] (2) extract the DNA of these 84 parts of materials, the extraction method is the same as example 1.

[0059] (3) PCR amplification and product detection are the same as in Example 1. The results are shown in Table 1 (S: Indicates susceptible, R: Indicates resistant, +: Indicates that the marker test result is positive, -: Indicates that the marker test result is negative), part of the electrophoresis results are shown in the appendix figure 1 . It can be seen from Table 1 that the detection results of the marker N2F / N2R are consistent with the TMV resistance controlled by the N gene, which proves that the primer is reliable in identifying the TMV resistance controlled by the N gene.

[0060] Table 1. Comparison of marker N2F / N2R detection results and variety (line) disease resistance

[0061] Variety

TMV resistance

N2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marking method for detecting a tobacco mosaic resistance gene (N gene), which comprises primer design, genome DNA extracting, PCR amplification and electrophoresis detection, and comprises the following specific steps: designing a specific primer according to the nucleotide sequence of the tobacco TMV resistance gene (N gene), amplifying a tobacco variety (strain) containing the TMV resistance gene (N gene)by a PCR reaction to obtain a feature band of 1200bp or so, and thus achieving the purpose of detecting whether the tobacco variety (strain) has TMV resistance. 84 cured tobacco materials are detected by the molecular markers of the invention, and the results are in accordance with the TMV resistance of the variety (strain). The method has the advantages of convenient operation, reliable result and high detection speed, and is not influenced by growth and development periods of plants. When the method is used for the seed selection of cured tobacco TMV resistant varieties, the selection efficiency can be greatly improved.

Description

Technical field: [0001] The present invention belongs to the field of biotechnology, and specifically relates to a method for detecting whether a tobacco variety (line) contains a TMV resistance gene (N gene), thereby predicting its resistance to TMV. Background technique: [0002] Tobacco Mosaic Virus (TMV) disease is one of the main diseases of tobacco. The field incidence rate is about 5-25% in general years, and more than 50% in severe disease years. It can occur from seedling stage to harvest stage. TMV infects infected plants with systemic symptoms: first, bright veins appear on new leaves, and mosaic leaves form after a few days. In severe cases, the diseased leaves are deformed, the internodes of the diseased plants are shortened in the early stage, the plants are dwarfed, and the growth is slow. Tobacco common mosaic disease occurs widely in the three northeastern provinces of China, Yunnan, Hunan, Hubei, Fujian, Sichuan and other smoking areas, seriously reducing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/94
Inventor 高玉龙肖炳光卢秀萍陈学军焦芳婵李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com