Method for detecting N gene-controlled tobacco TMV resistance by molecular markers
A marker detection and tobacco technology, applied in the biological field, can solve problems such as the success of inoculation with a large workload, and achieve the effects of fast detection, improved selection efficiency, and fast speed.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] (1) The partial nucleotide sequence of tobacco N gene is:
[0049] ( GGCATGACATCTCTGCTTCA GATTCCTTGTCACTAACAGTATTTACCGGTCAACCGTATCCTGAAAAGATCCCGAGTTGGTTCCACCATCAGGGTTGGGATAGTAGTGTATCAGTCAATTTGCCTGAAAATTGGTATATACCTGATAAATTCTTGGGATTTGCTGTATGTTACTCTCGTAGCTTAATTGACACAACAGCTCACTTGATTCCCGTATGTGATGACAAGATGTCGCGCATGACCCAGAAACTTGCCTTATCAGAATGTGATACAGAATCATCCAACTATTCAGAATGGGATATACATTTTTTCTTTGTACCTTTTGCTGGCTTATGGGATACATCTAAGGCAAATGGAAAAACACCAAATGATTATGGGATTATTAGGCTATCTTTTTCTGGAGAAGAGAAGATGTATGGACTTCGTTTGTTGTATAAAGAAGGACCAGAGGTTAATGCCTTGTTACAAATGAGGGAAAATAGCAATGAACCAACAGAACATTCCACTGGGATAAGGAGGACTCAATATAACAACAGAACTTCCTTTTATGTAAGTCTCTACTTCTATTAGCTACAAAGTCTTCTTCCAAAATCAATACTCCATCCGTTCCAGTTTATGTGAACCTATTTTTTGTTCGTCCATTCTAAAAAGAATGACCCCTTTCTAAATTTGGAAATAATTTTGGTTAAACTTATAATTCTACCATTAACGAGAAGCTTTTATAACCACACAAATATTCTGGGGCCCTTTTTGAATTGTTTAGGACCATAAATTCCAAAAGTCCTCATTTTTTCTTAAACTCCGTGCCCAATCAAACAAGTTCACGTAAATTGGAACGGAGGGAATATATTTTTTCTTCTCATTCTTTTCCCCTATTTACAGGAGCTCATCAATGGGTGATGTACATATCAACAAC...
Embodiment 2
[0057] (1) 84 flue-cured tobacco varieties (lines) were selected, and the resistance of these materials to TMV is shown in Table 1.
[0058] (2) extract the DNA of these 84 parts of materials, the extraction method is the same as example 1.
[0059] (3) PCR amplification and product detection are the same as in Example 1. The results are shown in Table 1 (S: Indicates susceptible, R: Indicates resistant, +: Indicates that the marker test result is positive, -: Indicates that the marker test result is negative), part of the electrophoresis results are shown in the appendix figure 1 . It can be seen from Table 1 that the detection results of the marker N2F / N2R are consistent with the TMV resistance controlled by the N gene, which proves that the primer is reliable in identifying the TMV resistance controlled by the N gene.
[0060] Table 1. Comparison of marker N2F / N2R detection results and variety (line) disease resistance
[0061] Variety
TMV resistance
N2...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com