Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers

A technology of RNA interference and multiple primers, applied in the field of biological gene cloning and expression technology, can solve the problems of not being suitable for high-throughput, time-consuming, and heavy workload, so as to avoid base synthesis errors, save time and cost, and reduce the probability of errors Reduced effect

Active Publication Date: 2013-02-06
HUBEI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Method (II) (III) is not only time-consuming and cumbersome, but also has a high probability of linking or self-ligating the vector to non-target fragments, which complicates the subsequent screening and identification process
[0007] 2. Not suitable for high-throughput operations
[0008] The fragments to be cloned in the above three methods all need to be purified in advance, and all rely on the ligation reaction between the carrier and the foreign fragments. Although this is feasible for the construction of a single or a small number of RNA interference vectors, it is difficult for large-scale construction of RNA interference vectors. but very difficult and inefficient
The oligonucleotide single strand used in method (I) and (II) is usually 60-100nt, and the oligonucleotide single strand of synthesizing this length not only improves synthetic cost greatly, and base synthesis error rate increases greatly, and then Greatly increased the workload of recombinant plasmid screening, time-consuming and laborious
The exogenous fragments in methods (II) and (III) all need to go through complicated steps such as double enzyme digestion and recovery. Because the exogenous fragments are generally small (within 200bp), the recovery and purification efficiency is low. These two methods not only The cost of the experiment is expensive, and the follow-up screening is difficult and the workload is heavy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers
  • Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers
  • Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Utilize the present invention, construct the plant artificial microRNA (amiRNA) expression vector (specific process sees figure 1 ).

[0032] 1) Transformation of the carrier

[0033] In this experiment, the plant binary vector pCAMBIA1301 was selected as the starting vector, and the vector was digested with EcoRI and BstEII and then ligated with the following fragments: 35S promoter-HindIII restriction site-gfp expression unit-NcoI restriction site (details The sequence is attached), to obtain the universal plant RNAi expression vector pYH1301-gfp (see figure 2 ).

[0034] 2) Design and annealing of oligonucleotide sequence

[0035] According to the rice miR528 precursor sequence reported in the literature (PLoS One.2008Mar 19; 3(3):e1829.), design the sequence that can transcribe the small RNA that interferes with the pds gene, and synthesize a set (8 in this case) of length It is an oligonucleotide sequence of about 50nt (the detailed sequence is attached).

[...

Embodiment 2

[0040] Utilize the present invention to construct the animal shRNA expression vector with mammalian interference vector pGenesil-1 (Wuhan Jingsai Bioengineering Co., Ltd.) as the backbone and GCTGTACTCCCCTTACATTA as the interference target sequence (see image 3 ).

[0041] 1) Transformation of the cloning vector

[0042] To analyze the vector sequence, first select the mammalian interference vector pGenesil-1 as the starting vector, linearize it with BamH I and Xho I double enzyme digestion, and fragment "Nb.BbvCI restriction site--front annealing sequence--EcoRV Restriction site--gfp expression unit--EcoRV restriction site--rear-end annealing sequence--Nb.BbvCI restriction site" connection (detailed sequence is attached) to obtain a general-purpose gene that can be used to construct animal shRNA expression vectors Type vector pGsilG-Lic ( Figure 4 );

[0043] 2) Design and annealing of oligonucleotide sequence

[0044] According to the principle in step 2) of the specif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing a RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers. The method mainly comprises the following three steps of: modifying the vector; annealing an oligonucleotide sequence; and cloning annealing products to RNAi. The method does not need to synthesize an oligonucleotide primer sequence with a length larger than 50nt and does not need to carry out operations including PCR (Polymerase Chain Reaction), recovery of small molecular DNA by enzyme digestion, ligase treatment and the like, but generates recombinant plasmids by using junction of respective protruding cohesive ends of the linear vector and the annealing products in Escherichia coli. The method is simple, convenient and fast and has the advantages of economy, visibility, convenient screening and high accuracy.

Description

technical field [0001] The present invention relates to biological gene cloning and expression technology, in particular to a method for constructing RNA interference (RNA interference, RNAi) vector quickly, efficiently, at low cost and with high throughput. It is especially suitable for large-scale construction of animal and plant RNAi expression vectors for functional research on animal and plant genes. Background technique [0002] RNA interference (RNA interference, RNAi) is a ubiquitous, sequence-specific, post-transcriptional gene silencing process that exists in organisms. At present, the rapid realization of gene silencing in vivo by using RNAi technology has become a powerful experimental tool in the study of gene function in animals and plants. [0003] Due to the characteristics of animals and plants and the differences in their mechanisms of RNAi, the molecules of RNAi used in the study of gene functions in animals and plants are also different. At present, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/113C12N15/82C12N15/85
Inventor马立新严红蒋思婧杨菊
OwnerHUBEI UNIV