Unlock instant, AI-driven research and patent intelligence for your innovation.

High-pass soybean gene-transferring method

A transgenic and soybean technology, applied in botany equipment and methods, biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem of low tissue culture system and transformation efficiency, cumbersome resistance screening procedures, genotype dependence and other problems, to achieve the effect of reducing pre-processing operations, simple operation process, and simple process

Inactive Publication Date: 2012-08-29
PEKING UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method avoids the complicated tissue culture system, low transformation efficiency, long cycle, and genotype dependence in the Agrobacterium transformation method. Technical defects such as specific resistance screening procedures and long screening cycles

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-pass soybean gene-transferring method
  • High-pass soybean gene-transferring method
  • High-pass soybean gene-transferring method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, obtaining transgenic soybean

[0035] 1. Gene transformation

[0036] 1. Experimental materials

[0037] 1) Vector: The vector used in the following examples is pGREEN0229, which can be purchased from http: / / www.pgreen.ac.uk / a-ord-fr.htm. Product code: PBII0229 (nos-Bar LB). The rest of the materials, reagents, etc. can be obtained from commercial sources.

[0038] 2) Cloning of TriGLUC gene

[0039] The young Trichomona leaf tissue (collected in Peking University campus) was taken, the total RNA was extracted by Trizol method, and cDNA was synthesized by RT-PCR reaction by conventional methods. Using TriGLUC-5 and TriGLUC-3 as primers (TriGLUC-5:CCTCCATGGCTCTTTTGCCG, TriGLUC-3:CTCTCAATTGAACTTGACTGG),

[0040] The complete sequence of the TriGLUC gene (sequence 1 in the sequence listing) was obtained by performing PCR reaction cloning with the cDNA of Trigalus chinensis as a template.

[0041] Synthetic cDNA specific steps:

[0042] (1) Add the foll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-pass soybean gene-transferring method. The method comprises the following steps of: adding gene transformation liquid into stigmas of soybean flowers dropwise; and harvesting seeds after soybeans are ripe. The method avoids the tissue damage caused by the cutting of the stigmas, and has small influence on the ripening rate and germination rate of T1 generation seeds. The method provided by the invention also comprises screening, and the screening comprises the following steps of: after the seeds sprout, spraying herbicides on leaves after main leaves are completely unfolded and before ternated leaves are unfolded. For further screening, molecular biological detection is also provided. The screening method has the advantages of simple operating flow, short time, low cost and suitability for high-pass screening; and resistant plantlets screened by the method has high positive rate, and the work load for molecular detection is reduced.

Description

technical field [0001] The invention relates to a high-throughput soybean transgene and screening method. Background technique [0002] Soybean is an important oil crop and an important source of vegetable protein and oil. In order to improve soybean resistance to pests and diseases and physiological adversity, improve soybean quality, and increase soybean yield, in addition to traditional breeding methods, genetic engineering can be used to achieve purposeful genetic engineering improvement. The genetic transformation of soybean is the key to study the function of soybean genes. However, due to the imperfect tissue culture system of soybean and the insensitivity of soybean tissue to Agrobacterium, the genetic transformation of soybean is difficult and inefficient, and has become a worldwide problem. [0003] The methods for exploring soybean genetic modification mainly include biolistic method, Agrobacterium-mediated method, electric stimulation method, PEG method, ovary i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00A01H5/10C12Q1/68G01N33/53
Inventor 安成才黄萍杨扬任姣邬倩滑瑞何善平付力文张起涛于祥春
Owner PEKING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More