Recombinant bacillus subtilis EV71-VP1 expression vector and preparation method and application thereof

An EV71-VP1, Bacillus subtilis technology, applied in the field of genetic engineering, can solve the problem of no definite and effective vaccine, and achieve the effect of high safety

Inactive Publication Date: 2011-04-13
INST OF BASIC MEDICINE OF SAMS
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Although many researchers have done a lot of research, there is no exact and effective vaccine applied to the prevention and treatment of EV71.
The use of Bacillus subtilis to express recombinant EV71-VP1 capsid protein to prepare mucosal pathway vaccine has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis EV71-VP1 expression vector and preparation method and application thereof
  • Recombinant bacillus subtilis EV71-VP1 expression vector and preparation method and application thereof
  • Recombinant bacillus subtilis EV71-VP1 expression vector and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Embodiment 1 constructs recombinant Bacillus subtilis EV71-VP1 expression vector, and carries out verification method as follows:

[0087] (1) Transferring the carrier protein gene:

[0088] (a) PCR method amplifies the (BGSC NO.1A771 strain) CotB gene regulatory sequence and coding sequence of Bacillus subtilis:

[0089] The upstream primer sequence for PCR amplification is: 5'GAATCCGAGTTTCGCAAGTCCT3';

[0090] The downstream primer sequence is: 5'CAAGCTTGGATGATTGATCATCTGAAGATTTT3';

[0091] Position: The enzyme cutting sites at both ends are EcoR I and HindIII respectively;

[0092] Amplification conditions are: 95°C for 4min, 30 cycles of amplification at 95°C for 30Sec, 53°C for 30Sec, and 75°C for 1min;

[0093] (b) Connect the above PCR amplification product to the pMD18T carrier (Dalian Bao Biological Kit), the reaction system is: 5 μL ligation buffer + 0.5 μL pMD18T vector + 4.5 μL target fragment; transform Escherichia coli DH5α, and send the positive PCR am...

Embodiment 2

[0128](1) The promoter and partial coding sequence (position -263~825nt) of the CotB gene (BSU36050cotB) of Bacillus subtilis were used as the carrier protein and the partial coding sequence of EV71VP1 was connected to the middle part of the integrated plasmid pDG1662 (BGSCAccession: ECE113) amyE gene .

[0129] Specific steps are as follows:

[0130] 1. Using the BGSC 1A771 strain genome as a template, pfu DNA polymerase was used to amplify the partial coding sequence of the carrier protein and its promoter by PCR.

[0131] The primer sequences are as follows:

[0132] Upstream: 5-AGCGCCGgaattcACGGATTAGGCCGTTTGTCC-3 (position: -263 / -244, containing EcoRI restriction site)

[0133] Downstream: 5-CAATCATCCaagcttGGATGATTGATCATCTGAAG-3 (position: +806 / +825, containing HindIII restriction site)

[0134] PCR amplification conditions: 95°C for 4min, (95°C for 30sec, 53°C for 30sec, 72°C for 1min) x 30 cycles.

[0135] Results: A 1088bp DNA fragment containing the CotB promoter a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacillus subtilis EV71-VP1 expression vector, the vector is an escherichia coli-bacillus subtilis shuttle expression vector, and a coding gene of capsid protein VP1 of EV71 virus is loaded on the vector. The construction method is as follows: (1) amplifying CotB gene regulatory sequence and coding sequence of bacillus subtilis, connecting to a pMD18T vector, and obtaining plasmid pDG1662-CotB; and (2) amplifying enterovirus 71 type capsid protein VP1 antigen sequence, connecting to the plasmid pDG1662-CotB, and obtaining plasmid pDG1662-CotB-VP1 which is the recombinant bacillus subtilis EV71-VP1 expression vector. After introducing the recombinant vector into host cells for culturing, oral vaccines for preventing or treating diseases caused by EV71 can be further prepared.

Description

technical field [0001] The invention relates to a recombinant Bacillus subtilis EV71-VP1 expression vector, a preparation method thereof, an expression host and an application as an oral vaccine, belonging to the field of genetic engineering. Background technique [0002] Enterovirus 71 (EV71) is a member of the genus Enterovirus in the family Picornaviridae. The genome of EV71 virus is a single positive-strand RNA containing about 7500 nucleotides. The EV71 virus particle is roughly spherical, without envelope and protrusions. The virus capsid is composed of 60 subunits connected to each other. Each subunit is composed of capsid proteins VP1, VP2, VP3, and VP4 encoded by the viral genome. VP1 , VP2, and VP3 are exposed on the surface of the viral capsid, while VP4 is embedded in the inner side of the viral capsid and tightly connected to the viral core. [0003] EV71 and coxsackievirus A16 (coxsackievirus A16, CA16) are common pathogens that cause HFMD in children and inf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C12N15/66C12N1/21A61K39/125A61K39/39A61P31/14C12R1/125
Inventor李志会宋楠楠岳盈盈李鹏孟红纪璇
OwnerINST OF BASIC MEDICINE OF SAMS