Unlock instant, AI-driven research and patent intelligence for your innovation.

Humanized recombinant uricase and mutant thereof

A uricase and mutant technology, applied in the field of DNA recombination technology and medicine, can solve the problems of lack of selection pressure, reduction of enzyme immunogenicity, inability to use long-term treatment, etc.

Active Publication Date: 2011-05-11
LUNAN PHARMA GROUP CORPORATION +1
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the uricase derived from Aspergillus flavus is less than 40% homologous to the inferred human uricase (Lee C C, Wu X, Gibbs R A, Cook R G, Muzny D M, Caskey C T.Science.1988.239: 1288-1291.) , the human body is prone to produce anti-uricase antibodies, the efficacy of Aspergillus flavus uricase rapidly weakens, and at the same time cause severe allergic reactions, so it cannot be used for long-term treatment
If it is modified to restore its enzyme activity for degrading uric acid, the immunogenicity of the enzyme will be reduced. However, during the evolution of the human uricase gene, due to the lack of selection pressure, some missense mutations have accumulated. The inventors carried out Multiple amino acid mutations to restore uricase activity, all unsuccessful

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized recombinant uricase and mutant thereof
  • Humanized recombinant uricase and mutant thereof
  • Humanized recombinant uricase and mutant thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0046] Example 1 Recombinant expression of human dog chimeric uricase protein UHC in Escherichia coli

[0047] In this example, the first 240 amino acids at the N-terminal of the involved chimeric protein are the uricase sequence of dog origin, and the 241-304th amino acid sequence is the amino acid sequence of uricase of human origin. According to the above amino acid sequence and according to the codon preferred by Escherichia coli, Bao Biology (Dalian) Co., Ltd. was entrusted to carry out the whole gene synthesis. The nucleotide sequences are (Seq ID No: 10): CAT ATG GCC CAT TAT CAT AAT GAT TAT AAA AAA AAT GAT GAA GTT GAA TTT GTT CGT ACC GGT TAT GGTAAA GAT ATG GTT AAA GTT CTG CAT ATT CAG CGT GAT GGT AAA TAT CAT TCT ATT AAA GAA GTT GCC ACCTCT GTT CAG CTG ACC CTG TCT TCT AAA AAA GAT TAT GTT TAT GGT GAT AAT TCT GAT ATT ATT CCA ACCGAT ACC ATT AAA AAT ACC GTT CAT GTT CTG GCC AAA TTT AAA GGT ATT AAA TCT ATT GAA ACC TTT GCCATG AAT ATT TGT GAA CAT TTT CTG TCT TCT TTT AAT CAT GTT AT...

example 2

[0052] Example 2 Human dog chimeric uricase protein UHC mutant DNA construction and recombinant expression in Escherichia coli

[0053] Using the UHC protein DNA sequence as the original template, the DNA containing the target mutation was mutated by the staggered extension PCR method (attached image 3 ). The following is an example of preparing S246T-S248G-R249Q and S246T-S248G-R249Q-F266L:

[0054] Primer number

dna sequence

Primer 1 (Seq ID No: 11)

5′CACGACATATGGCCCATTATCATA 3′

Primer 2 (Seq ID No: 12)

5′ GGATCCTTATCACAGACGAGAA 3′

Primer 3 (Seq ID No: 13)

5′ACCCTGGGTCAGGTTCCAGAAATTGAAGATATGGAAATT 3′

Primer 4 (Seq ID No: 14)

5′TTCTGGAACCTGACCCAGGGTCAGAACCTGAATATCATA3′

Primer 5 (Seq ID No: 15)

5′TTCATTATCTGAATATTGATATGTCTAAAAA 3′

Primer 6 (Seq ID No: 16)

5′ATCAATATTCAGATAATGAATATTGGCAG 3′

[0055] Prepare UHC 246 / 248 / 249 : first-stage PCR: the template sequence is the whole gene synthesis...

example 3U

[0058] Example 3UHC chimeric protein and mutant protein Escherichia coli expression product purification

[0059] Take 50g of bacterial precipitates and add 500ml of bacteriostasis solution, the pH of the bacteriostasis solution is 8.2, containing 25mM Tris-HCl, 0.1mg / ml lysozyme, stir at 37°C for 2 hours, and ultrasonically destruct the above bacteria solution (500W 4S, interval 6S, 30 times); centrifuge to discard the supernatant, precipitate with 2L pH 10.20.1M Na 2 CO 3 Dissolve and stir overnight at room temperature; discard the precipitate by centrifugation, add 15% saturated ammonium sulfate to the supernatant, and precipitate at 4 degrees for 2 hours; discard the supernatant by centrifugation, and use 2L pH 10.20.1M Na 2 CO 3 Dissolve and stir at room temperature overnight; centrifuge to discard the precipitate, and the supernatant is purified by QAE agarose anion exchange chromatography column (GE). 2 CO 3 ) was eluted, and the target protein was eluted at 0.3M Na...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides chimeric protein of mammal-derived uricase which contains part of humanized uricase amino acid sequences and has enzymatic activity and mutant protein thereof, a deoxyribonucleic acid (DNA) sequence encoding the chimeric protein, a carrier containing the DNA sequence, a host cell containing the carrier, a method for preparing the chimeric protein and the mutant protein thereof by genetic engineering and a medicinal composition. The chimeric protein and the mutant protein reserve the activity of the mammal-derived uricase, can reduce immunogenicity suitable for human bodies and enhance or improve the physicochemical property of mammal source uricase protein simultaneously, and are suitable for treating hyperuricemia and gout caused by the hyperuricemia.

Description

technical field [0001] The invention relates to the fields of DNA recombination technology and medicine. More specifically, the present invention relates to a chimeric protein of a mammalian uricase with enzymatic activity and a mutant protein thereof containing a part of the amino acid sequence of human uricase, and a DNA sequence encoding the chimeric protein and a mutant thereof, comprising the The carrier of the DNA sequence, the host cell containing the carrier, the method for preparing the protein by genetic engineering, and the application of the protein in the treatment of hyperuricemia and the ventilation caused by it. Background technique [0002] Gout is a disease caused by purine metabolism disorders. As early as the 5th century BC, the famous Greek doctor Hippocrates had recorded its symptoms (Emmerson B T.N Engl J Med.1996; 334; 445-451.) , its clinical feature is hyperuricemia, and tophi is formed due to urate deposition in the subcutaneous, joints, and kidne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/06C12N15/53C12N15/63C12N1/21C12N1/19C12N5/10A61K38/44A61P19/06C12R1/19
CPCA61K38/00C12N9/0012C12Y107/03003C12N9/0048A61P19/06
Inventor 范开张淳马雪丰梅翔胡春兰
Owner LUNAN PHARMA GROUP CORPORATION