Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof

An arginine deiminase and a construction method technology, which can be applied in the directions of microorganism-based methods, botanical equipment and methods, biochemical equipment and methods, etc., and can solve problems such as limiting the application prospects of recombinant ADI enzymes.

Inactive Publication Date: 2011-05-18
JIANGNAN UNIV
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the optimum pH of the recombinant ADI is 6.0, and the residual enzyme activity at physiological pH 7.4 is lower than 10%, and K m High (2.88mmol / L, pH6.0), which limits the application prospect of this recombinant ADI enzyme as an anticancer drug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof
  • Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof
  • Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 Construction of recombinant ADI

[0024] According to the gene sequence of the ADI, design primers:

[0025] F: 5'-GCT CATATG TCCGCTGAAAAACAGAAGTACG-3’ ( Nde I)

[0026] R: 5'-AT CTCGAG TTAGTAGTTGATCGGGTCGCGCA -3' ( xho I)

[0027] Introduce upstream and downstream separately Nde I and xho I enzyme cutting site (underlined), the primers used in the present invention were all synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0028] Using Pseudomonas mutans cells as a template, the ADI gene fragment was amplified by PCR, and the reaction system was 50 μL, as shown in Table 1:

[0029] Table 1 PCR amplification reaction system of ADI gene fragment

[0030] 10×Ex Taq Buffer

[0031] Reaction program: Denaturation at 94 °C for 10 min; reaction at 94 °C for 1 min, 56 °C for 45 s, and 72 °C for 2 min for 30 cycles, followed by extension at 72 °C for 10 min to obtain the PCR product ADI.

[0032]The PCR product A...

Embodiment 3

[0051] Example 3 Screening of ADI mutant library

[0052] A single colony in the ADI mutant library was transferred to an LB / Kan plate containing IPTG (final concentration 0.2 mmol / L), and cultured at 30°C until a single colony grew.

[0053] According to the reaction that ADI catalyzes arginine to produce citrulline and ammonia, a 96-well plate screening method for mutants with ADI activity was designed. Specific operation: Take a 96-well plate, first add 50 μl of 0.2mol / L phosphate buffer solution (pH 7.4) to each well, pick a single colony induced by IPTG and mix it in the well (the sample without bacteria is used as a control), Then add 50 μl of 1 mmol / L L-arginine hydrochloride, 0.2 mol / L phosphate buffer (pH 7.4), react at 37°C for 15 min, add 90 μl of mixed acid to terminate the reaction, and then add 30 μl of diacetylmonoxime-sulfur Amidurea solution, mix well, react at 37°C for 2 hours, measure OD 530 . The reaction solution in the well where the strain with ADI ac...

Embodiment 4

[0054] Example 4 ADI mutant strain M314

[0055] A single colony of the ADI mutant strain M314 was inserted into LB / Kan liquid medium and cultured overnight at 37°C and 200r / min. Bacteria were collected, plasmids were extracted, and purified. The plasmid was sequenced by Shanghai Sangon Bioengineering Technology Service Co., Ltd. See SEQ ID NO: 1 in the sequence table. It was determined that M314 carried three mutation sites, namely A128T, H404R and I410L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction of a recombinant strain capable of producing arginine deiminase (ADI) and a directional modification method thereof, belonging to the technical field of medical biological engineering. The method comprises the following steps of: amplifying the ADI coding gene arcA of a pseudomonas plecoglossicida CGMCC (China General Microbiological Culture Collection Center) No. 2039 by adopting a PCR (polymerase chain reaction) method, and constructing an ADI recombination expression strain, researching the enzymology properties of the recombinant ADI enzyme, wherein Km is 2.88mmol / L (pH is 6.0), the optimal pH is 6.0, the enzyme activity is 20.85U / mg, and the enzyme activity is reduced by more than 90% when the pH is increased to the physiological pH (7.4). The directional modification is carried out on the recombinant ADI enzyme by adopting a prone PCR mutation technology, so as to improve the activity and substrate affinity of the enzyme under the physiological pH condition. An excellent mutant strain ADIM314 is obtained by screening through the directional modification. Compared with a wild enzyme, the activity of the ADIM314 enzyme under the physiological pH condition is improved by more than 20 times, the Km value is reduced to 0.65mmol / L (pH is 7.4), and the optimal pH is improved to 6.5 from 6.0.

Description

technical field [0001] The invention includes a method for constructing arginine deiminase (ADI) recombinant bacteria and its directional transformation by using genetic engineering technology, and belongs to the technical field of medical bioengineering. Background technique [0002] Arginine deiminase (EC 3.5.3.6, referred to as ADI) is a potential new anticancer drug for the treatment of arginine-deficient tumors, including liver cells that currently lack effective drug therapy tumors (hepatocellular carcinomas, referred to as HCCs) and melanomas (melanomas). People's understanding of the anticancer activity of ADI began with the important role played by arginine on the growth of tumor cells. Arginine is a non-essential amino acid for normal cells in humans as well as mice because arginine can be synthesized from citrulline by two enzymes in the urea cycle, argininosuccinate synthase (ASS) and arginine produced by aminosuccinate lyase (AL). However, some arginine-defic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/55C12N9/78C12R1/38
Inventor倪晔孙志浩郑璞
OwnerJIANGNAN UNIV