Fluorescence quantitative PCR (Polymerase Chain Reaction) detection method and kit for HPIV (Human Parainfluenza Virus)
A fluorescence quantitative and detection method technology, applied in the field of molecular biology, can solve the problems of difficult detection, and achieve the effect of long time, high specificity and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] According to the comparison and analysis of HPIV-related sequences (HPU70948) in GeneBank, primers and probes were designed and prepared:
[0029] Primer 1: 5`-ATGTGCTATCAAGACCAGGAAAC-3` (Seq No.1)
[0030] Primer 2: 5`-CGTTTACTCTTTTCGGTTGCTGT-3` (Seq No.2)
[0031] Probe 1: 5`ACTGGGTTCACTCTCGATTTTTGT-3` (Seq No.3)
[0032] Design and prepare synthetic RNA sequences:
[0033] 5-AUGUGCUAUCAAGACCAGGAAACAAUGAAUAGACUCACAAAAAUCGAGAGUGAACCCAGUCAUCAACAGCAACC
[0034] GAAAGAGUAAACG-3` (Seq No.4)
[0035] The artificially synthesized RNA sequence was dissolved in DEPC-treated water and diluted to 1E+6copies / ml, 1E+5copies / ml and 1E+4copies / ml, which were successively used as calibrator 1-3.
[0036] One step RT-PCR reaction buffer (final concentration) was prepared according to the following formula: 50mM Tris-HCl (Ph 8.3), 50mM KCl, 300uM dNTP, 3mM MgCl2, 200nM primer 1, 200nM primer 2 and 200nM probe 1.
[0037] Probes (final concentration) were prepared according to the ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com