Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant fertility associated protein and coding gene and use thereof

A technology for encoding genes and plants, applied in the field of genetic engineering, can solve the problems of cumbersome seed production and heavy workload, and achieve the effect of promoting development and growth, broad application space and market prospects

Active Publication Date: 2011-08-03
TSINGHUA UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional three-line matching requires three lines, so the workload is heavy and the seed production is relatively cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant fertility associated protein and coding gene and use thereof
  • Plant fertility associated protein and coding gene and use thereof
  • Plant fertility associated protein and coding gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, the acquisition of MYB21CDS gene

[0036] Extract the RNA of Arabidopsis thaliana Columbia-0 ecotype (Arabidopsis BiologicalResource Center (ABRC), seed number: CS6673) flower, reverse transcribe to obtain cDNA, use cDNA as template, use primer 1: agctctagaatggagaaaagaggagggaggaag and primer 2: atcgagctctcaattaccattcaataaatgca, for PCR amplification. The resulting PCR products were sent for sequencing. The result is that the PCR product has the nucleotides shown in sequence 1 in the sequence listing, the gene of the PCR product is named MYB21CDS, and the gene coding region is the 1-681st nucleotides from the 5' end of sequence 1 in the sequence listing, The protein encoded by the gene is named MYB21CDS, and the amino acid sequence of the protein is sequence 2 in the sequence listing.

[0037] Sequence 1 in the Sequence Listing can also be artificially synthesized.

Embodiment 2

[0038] Embodiment 2, the acquisition of transmuting MYB21CDS Arabidopsis

[0039] 1. Acquisition of overexpression vector pCambia 1301-MYB21CDS

[0040] The above PCR product was digested with XbaI and SacI, and the resulting fragment was digested with pCambia1301 (GenBank number: AF234297, Gibberellin Acts through Jasmonate to Control the Expression of MYB21, MYB24 and MYB57 to Promote Stamen Filament Growth in Arabidopsis. Cheng Hui, Song Susheng, Xiao Langtao, Soo Hui Meng, Cheng Zhiwei, Xie Daoxin, Peng Jinrong. PLoS Genetics 5(3): e1000440.2009, publicly available from Tsinghua University.) Large fragment ligation, the obtained ligation product, transferred to Escherichia coli to obtain transformants. The plasmid of the transformant was extracted and sent for sequencing. As a result, the plasmid was a vector obtained by inserting sequence 1 in the sequence table between the XbaI and SacI restriction sites of pCambia 1301, and the plasmid was named pCambia 1301-MYB21CDS. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
lengthaaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a plant fertility associated protein and a coding gene and use thereof. The protein provided by the invention is named MYB21CDS and is derived from Arbidopsis thaliana. The protein may be a protein 1) and a protein 2), wherein the protein 1) is formed by an amino acid sequence represented by the sequence No.2 in a sequence table; and the protein 2) is formed by substituting and / or losing and / or increasing one or several amino acid residues in the amino acid sequence represented by the sequence No.2. Experiments conducted in the invention prove that the gene MYB21CDS provided by the invention leads to male sterility of plants after overexpression. In production, the gene can be expressed under induction to produce a sterile line which can serve as a female parent tobe crossed with a male parent to produce hybrid seeds.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a protein related to plant fertility and its coding gene and application. Background technique [0002] Plant male sterility, that is, male sterility due to defects in the development of stamens in the floral tissues of plants. The cloning of key genes of male sterility is of great significance to the current agricultural production and application. Male sterility can be used to construct female parent inbred lines of hybrids. In the breeding process, high-yield and high-quality hybrids can be obtained by crossing the sterile female inbred line with the fertile male inbred line. CMS lines, maintainer lines and restorer lines are currently used in the breeding process. The maintainer line is used to cross the sterile line to produce a new sterile line as the female inbred line for seed production. Moreover, most of the sterile lines currently used in production are caused by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 谢道昕宋素胜齐天从黄煌彭文
Owner TSINGHUA UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More