Plant fertility associated protein and coding gene and use thereof
A technology for encoding genes and plants, applied in the field of genetic engineering, can solve the problems of cumbersome seed production and heavy workload, and achieve the effect of promoting development and growth, broad application space and market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1, the acquisition of MYB21CDS gene
[0036] Extract the RNA of Arabidopsis thaliana Columbia-0 ecotype (Arabidopsis BiologicalResource Center (ABRC), seed number: CS6673) flower, reverse transcribe to obtain cDNA, use cDNA as template, use primer 1: agctctagaatggagaaaagaggagggaggaag and primer 2: atcgagctctcaattaccattcaataaatgca, for PCR amplification. The resulting PCR products were sent for sequencing. The result is that the PCR product has the nucleotides shown in sequence 1 in the sequence listing, the gene of the PCR product is named MYB21CDS, and the gene coding region is the 1-681st nucleotides from the 5' end of sequence 1 in the sequence listing, The protein encoded by the gene is named MYB21CDS, and the amino acid sequence of the protein is sequence 2 in the sequence listing.
[0037] Sequence 1 in the Sequence Listing can also be artificially synthesized.
Embodiment 2
[0038] Embodiment 2, the acquisition of transmuting MYB21CDS Arabidopsis
[0039] 1. Acquisition of overexpression vector pCambia 1301-MYB21CDS
[0040] The above PCR product was digested with XbaI and SacI, and the resulting fragment was digested with pCambia1301 (GenBank number: AF234297, Gibberellin Acts through Jasmonate to Control the Expression of MYB21, MYB24 and MYB57 to Promote Stamen Filament Growth in Arabidopsis. Cheng Hui, Song Susheng, Xiao Langtao, Soo Hui Meng, Cheng Zhiwei, Xie Daoxin, Peng Jinrong. PLoS Genetics 5(3): e1000440.2009, publicly available from Tsinghua University.) Large fragment ligation, the obtained ligation product, transferred to Escherichia coli to obtain transformants. The plasmid of the transformant was extracted and sent for sequencing. As a result, the plasmid was a vector obtained by inserting sequence 1 in the sequence table between the XbaI and SacI restriction sites of pCambia 1301, and the plasmid was named pCambia 1301-MYB21CDS. ...
PUM
Property | Measurement | Unit |
---|---|---|
length | aaaaa | aaaaa |
length | aaaaa | aaaaa |
length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com