Unlock instant, AI-driven research and patent intelligence for your innovation.

Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application

An expression vector, the technology of Vibrio eel, applied in the application, antibody medical components, medical preparations containing active ingredients, etc., can solve the problems that have not yet been seen, and achieve the effects of unique and ingenious design, good immune protection effect, and easy use.

Active Publication Date: 2011-08-17
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no commercialized multi-potency live attenuated bacterial vaccine that mainly targets Vibrio anguillarum and Edwardsiella tarda

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application
  • Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application
  • Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The construction of embodiment 1 recombinant expression vector

[0039] 1.1 Primer design

[0040] Primers gapA-Lo-F (sequence shown in SEQ ID NO: 3), gapA-Lo-R (sequence shown in SEQ ID NO: 4) were designed according to the sequence (gapA40) shown in SEQ ID NO: 1; gapA-N-F ( sequence shown in SEQ ID NO: 5), gapA-N-R (sequence shown in SEQ ID NO: 4); gapA-F (sequence shown in SEQ ID NO: 6), gapA-R (sequence shown in SEQ ID NO: 7 ); N-F (sequence shown in SEQ ID NO: 10) and N-R (sequence shown in SEQ ID NO: 11) were designed according to the sequence shown in SEQ ID NO: 8, and the sequences of the above primers and the enzyme cleavage sites therein are as follows:

[0041] gapA-Lo-F: CCG GAATTC ATGACTATCAAAGTA (EcoRI restriction site)

[0042] gapA-Lo-R:CCA CTGCAG TTACTTAGAGATGTGTGCGA (PstI restriction site)

[0043] gapA-N-F: CGC GGATCC ATGACTATCAAAGTAGGTAT (BamHI restriction site)

[0044] gapA-N-R: Same as gapA-Lo-R

[0045] gapA-F: TAGGA GAATTC GATGACTAT...

Embodiment 2

[0064] Example 2 Construction of Vibrio anguillaris Recombinant Strain

[0065] Vibrio anguillarum MVAV6203 (from the China Center for Type Culture Collection, the preservation number is: CCTCC NO: M 204066, the preservation date is September 7, 2004, please refer to Chinese patent ZL200410089496.0 for details, and the application date is December 2004 14) inoculated in 30ml of high-salt LB culture solution (in order to add NaCl to the LB medium to a final concentration of 2.5%), shake and cultivate overnight at 30°C, and then transfer to 1:100 (v / v) Inoculate in 100ml of fresh high-salt LB culture medium, shake and culture at 200rpm at 30°C until the OD600 value is 0.4-0.6, collect the bacteria by centrifugation, place the bacteria in an ice bath for 20-30min, and use 272mM sucrose Wash the cells with buffer for 3 times, and then suspend the cells with sucrose buffer to make the final concentration of cells reach 1*10 9 cfu / ml or more, the electrotransformation competent cel...

Embodiment 3

[0070] Embodiment 3 multi-potency attenuated live vaccine screening

[0071]The recombinant bacterial strains VA (pG40), VA (pNG40), VA (Plorf1G40), VA (PluG40), VA (Pworf1G40) and VA (PwuG40) obtained in the steps of Example 2 were respectively inoculated in the culture medium containing 200 μg / ml ampicillin In LB high-salt liquid medium, 200rpm, 30°C cultured overnight, inoculated in 100ml LB high-salt (Amp) medium the next day at 1:100 (v / v), cultured at 30°C, 200rpm for 20h, and harvested the culture medium.

[0072] After the bacterial pellet was washed 3 times with PBS (PH=7.4), resuspended with 1ml PBS, and set to OD with Nano Drop nucleic acid quantifier 600 =1, sonicate in an ice bath for 5 minutes until the cells are completely broken, and centrifuge the obtained lysate at 4°C and 8000g for 2 minutes to obtain the whole bacterial fraction. The whole bacterial components were tested by ELISA, and the results were as follows: image 3 shown.

[0073] image 3 It wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine which is obtained by transferring a vibro anguillarum attenuated strain through a constructed recombinant expression vector, wherein a 3-phosphoglycerol dehydrogenase is displayed on the surface of a vibrio anguillarum attenuated strain cell by an ice nucleus protein outer membrane positioning element of the recombinant expression vector-expressed pseudomonas syringae and the fusion protein of the 3-phosphoglycerol dehydrogenase of the edwardsiella tarda through the ice nucleus protein outer membrane positioning element. The invention further provides a correlative expression vector and application. The vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine is unique and ingenious in design, vibrio anguillarum and edwardsiella tarda-resistant, good in immune protection effect, simple in use, safe, and low in cost. The invention provides a safe, efficient and ecumenical mode to the diseases for preventing the cultured fishes, has practical business development and application value, and is suitable for the large-scale popularization and application.

Description

technical field [0001] The present invention relates to the technical field of vaccines, more specifically to the technical field of multivalent live vaccines, in particular to a multivalent live vaccine against Vibrio anguillarum and Edwardsiella tarda, related expression vectors and applications. Background technique [0002] China is a big country in the aquaculture industry, but with the development of high-density large-scale aquaculture technology, disease problems have become increasingly prominent, posing a huge threat to the aquaculture industry. According to preliminary statistics, there are currently 400-500 kinds of diseases that endanger aquaculture organisms in my country. The annual incidence of aquaculture in the country is over 50%, and the loss rate is about 20%. There are more than 200 kinds of fish diseases. Among them, vibriosis and Edwardsiella are two major types of diseases that often break out in aquaculture, and the fatality rate is extremely high....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/62C12N15/31C12N15/53C12N9/04C07K14/195A61K39/106A61P31/12
Inventor 刘琴张元兴郑雁王启要
Owner EAST CHINA UNIV OF SCI & TECH