General TaqMan real-time fluorescent quantitative polymerase chain reaction (PCR) detection kit for dengue virus

Abstract

The invention discloses a general TaqMan real-time fluorescent quantitative polymerase chain reaction (PCR) detection kit for dengue virus. A general primer sequence comprises a forward primer sequence GCATATTGACGCTGGGAGAGA and a reverse primer sequence GCGTTCTGTGCCTGGAATG; and a probe sequence is AGATCCTGCTGTCTCTACA, and a minor groove binder (MGB) group is marked at the probe 3' end. In the kit, the TaqMan real-time fluorescent quantitative PCR detection is performed by a two-step method; and the kit comprises a general primer and a probe for detecting the dengue virus, a dengue virus gene reverse transcription PCR reaction reagent, a TaqMan real-time fluorescent quantitative PCR reaction reagent and a dengue virus standard substance. A method has the advantages of high sensitivity and specificity and the like and can be operated easily and quickly, the dengue virus from I to IV type can be detected simultaneously, and the method has the significant practical application value for the clinical early diagnosis of the dengue virus.

Description

technical field [0001] The invention relates to a dengue virus detection primer, a probe and a real-time fluorescent quantitative PCR detection kit. Background technique [0002] Dengue virus (dengue virus, DENV) is a single-stranded positive-sense RNA virus belonging to the family Flaviviridae, with a total length of about 11 kb, containing only one long open reading frame, encoding three structural proteins and seven a nonstructural protein. According to the antigenicity of E protein, it is divided into four serotypes: type I, type II, type III and type IV. Dengue virus transmission vectors are mainly Aedes aegypti and Aedes albopictus, which can cause dengue fever (dengue fever, DF), dengue hemorrhagic fever (dengue hemorrhagic fever, DHF) and dengue shock syndrome (dengue shock syndrome, DSS), Among them, DHF and DSS are severe forms of the disease, often causing death. [0003] Dengue virus infection is widely present in more than 90 countries and regions in tropical...

AI Technical Summary

Problems solved by technology

Since it usually takes 5-7 days for antibodies to appear to a detectable level, and dengue fever antibodies have cross-reactions with other flaviviruses and have low specificity, serological detection still has certain limitations as an early diagnostic method; dengue virus Isolation is a more reliable method, but the isolation and identification of dengue virus takes a long time and has low sensitivity, which is not conducive to the early diagnosis of the disease

The dengue virus nucleic acid detection technology developed in the past 10 years has provided the possibility for the early diagnosis of dengue fever. For example, RT-PCR can carry out the identification and typing diagnosis of dengue virus within 1 day of the patient's onset, but this method also has its own Defects, it is easy to cause cross-contamination between samples and there is a serious problem of false positives