Specific promoter of pathogenic filamentous fungi and use thereof

A filamentous fungus and promoter technology, applied in fungi, using vectors to introduce foreign genetic material, microorganisms, etc., can solve the problem of unreported gene regulation

Active Publication Date: 2011-11-02
CHONGQING UNIV
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been some reports on gene expression during appressorium formation of pathogenic fungi, but there is no report on gene regulation during appressoria formation and differentiation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific promoter of pathogenic filamentous fungi and use thereof
  • Specific promoter of pathogenic filamentous fungi and use thereof
  • Specific promoter of pathogenic filamentous fungi and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Isolation of promoter

[0023] The strain used in the present invention is Metarzhizium acridum strain CQMa102. Take the CQMa102 strain 10 cultured on 1 / 4SDAY medium (glucose 10g / L, peptone 2.5g / L, yeast extract 5.0g / L, agar 18g / L, pH adjusted to 6.0) 5 The spores were inoculated in 1.5ml 1 / 4SDAY liquid medium, cultured with shaking at 250rpm at 28°C for 3 days, and genomic DNA was extracted with a fungal gene DNA extraction kit (Bioflux, Hangzhou).

[0024] Align the cloned Magas1 gene sequence with the existing Metarhizium anisopliae genome sequence to obtain the upstream part of the Magas1 gene sequence, analyze by the promoter prediction software, cut off a 1222bp sequence, and design the primer PMagas1F5’CG actagt TTGTACGGAGTACTCCAG ACGT3’ (with SpeI restriction site) and PMagas1R5’CA gggccc GGATAAGGTAGGGGGTTTTGTA3' (containing ApaI restriction site). Use the extracted genomic DNA as a template for amplification. Amplification system (25μl): 10×LA Taq buff...

Embodiment 2

[0025] Example 2: Construction of PMagas1-EGFP expression vector

[0026] Design primer EGFPF5’AT according to EGFP sequence gggccc ATGGTGAGCAAGGGCGAGG3’ (underlined is the ApaI restriction site) and EGFPR5’CA cccggg TTACTTGTACAGCTCGTCC3' (the SmaI restriction site is underlined), the EGFP sequence was amplified from the pEGFPN-1 plasmid (BD, USA), and the sequence was verified by sequencing. The EGFP amplified product was digested with ApaI and SmaI and inserted into PDPB-PMagas1 which was also cut with ApaI and SmaI. Construct the PDPB-PMagas1-EGFP vector. After transforming E. coli, the plasmid is extracted. Cut the PDPB-PMagas1-EGFP vector with SpeI to cut out the expression element PMagas1-EGFP and insert it into the pK2 vector containing Bar resistance to construct the pK2-PMagas1-EGFP expression vector. The vector diagram is as follows figure 1 Shown.

Embodiment 3

[0027] Example 3: Transformation of Metarhizium anisopliae with PMagas1-EGFP expression vector and identification

[0028] The PMagas1-EGFP expression vector was transformed into Agrobacterium tumefaciens EAH105 strain (Beijing Dingguo) by electrotransformation, and then subjected to PCR verification. By Agrobacterium-mediated method (Fang, W., Zhang, Y., Yang, X., Zheng, X., Duan, H., Li, Y., Pei, Y., 2004. Agrobacterium tumefaciens-mediated transformation of Beauveria bassiana using an herbicide resistance gene as a selection marker. J Invertebr Pathol 85, 18-24), transforming Metarhizium anisopliae CQMa102. On Cha's medium containing 80μg / ml herbicide (sucrose 30g / L, NaNO 3 2g / L, KH 2 PO 4 1g / L, MgSO 4 0.5g / L, KCl 0.5g / L, FeSO 4 0.01g / L, 15g / L agar) screen transformants. After culturing for 10 days, the transformants were selected to culture on 1 / 4SDAY, and the genomic DNA of the transformants were extracted with a fungal gene DNA extraction kit (Bioflux, Hangzhou), and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific promoter of pathogenic filamentous fungi. The nucleotide sequence of the specific promoter at least contains a DNA sequence represented by SEQ ID No.1, or a DNA sequence complementary to the sequence represented by the SEQ ID No.1, or a DNA sequence which is 90 or above familiar with the sequence represented by the SEQ ID No.1 or the complementary sequence of the sequence represented by the SEQ ID No.1 and has the same functions with the sequence represented by the SEQ ID No.1 or the complementary sequence of the sequence represented by the SEQ ID No.1. Experiment researches prove that the promoter can be specifically and effectively expressed in a period of appressorium. The promoter provides an important tool for studying the regulation of the pathogenic filamentous fungi in an appressorium formation and permeation into body wall of a host and reconstructing wild insect pathogenic strain gene engineering and has a very high application value.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a filamentous fungus specific promoter and its application. Background technique [0002] Pathogenic filamentous fungi, including phytopathogenic fungi and entomopathogenic fungi, when infecting the host, they must first form an infecting structure appressorium. The function of appressorium is to provide mechanical pressure and secrete hydrolase to form an infection nail to penetrate the host body wall; therefore, the formation of appressorium is essential for the successful infection of the host by pathogenic filamentous fungi. At present, there have been some reports on gene expression during appressorium formation of pathogenic fungi, but there are no reports on gene regulation during appressorium formation and differentiation. Summary of the invention [0003] The purpose of the present invention is to provide a specific promoter for pathogenic filamentous fungi, which is d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/80C12N1/15C12R1/645
Inventor曹月青焦润夏玉先朱祥先
OwnerCHONGQING UNIV