Rapid detection method of citrus decay virus by rt-lamp
An RT-LAMP, decay virus technology, applied in the field of agricultural science and biotechnology applications, can solve the problems of long time, low sensitivity, complicated operation, etc., and achieve the effects of high accuracy, high sensitivity and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0044] Below in conjunction with specific embodiment the present invention is described in further detail:
[0045] The invention provides a rapid detection method of citrus decay virus RT-LAMP. According to the gene sequences of different strains of citrus decay virus (CTV) published by GenBank, 4 RT-LAMP specific primers (sequences below) of CTV were designed for the relatively conserved region of the sequence of citrus decay virus (CTV). The strain was used as a template, and an RT-LAMP method that could detect all citrus decay viruses was established. Diagnosis is then based on the electropherogram.
[0046] Primer design:
[0047] The conserved sequence of CTV and the specific primer sequence designed for RT-LAMP:
[0048]
[0049]F3: cgaagtggatttgtctgaca
[0050] B3: ggaatccctgcatctagcg
[0051] FIP: actcgaagggcgttagtacggctttggactgacgtcgtgtt
[0052] BIP: ctggggtagactaacgatgccgacgtccgccataactcaa
[0053] The specific detection method steps are:
[0054] 1) Ext...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com