Rapid detection method of citrus decay virus by rt-lamp

Abstract

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.

Description

technical field [0001] The invention belongs to the application field of agricultural science biotechnology, and relates to an RT-LAMP detection technology for detecting citrus decay virus and a kit based on the technology. Background technique [0002] Citrus decay disease caused by citrus decay virus (CTV) is one of the main diseases of citrus, seriously endangering the citrus industry. CTV detection is an important prerequisite and link for virus control, epidemic trend research, identification of citrus virus-free seedlings, and screening of attenuated strains. In the existing technology, the misjudgment rate based on the disease is high, the sensitivity of serological technology is low, and the detection technology of reverse transcription polymerase chain amplification (RT-PCR) is complex and time-consuming, expensive, and requires expensive PCR equipment, etc. shortcoming. [0003] The full name of LAMP technology is loop-mediated constant temperature amplification ...

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problems in the prior art, such as the low sensitivity of enzyme-linked immunoassay technology, the complex operation and long time of reverse transcription and nested PCR technology in the commonly used detection technology of citrus decay virus, the purpose of the present invention is to provide a simple-to-operate, low-cost , RT-LAMP detection method for citrus decay virus with less time, strong specificity and high sensitivity

Images