Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

33results about How to "Early diagnosis is accurate" patented technology

Preparation method of sericin-gadolinium pH responsive targeting tumor nuclear magnetic resonance contrast agent

The invention belongs to the technical field of magnetic resonance imaging (MRI) contrast agents, and discloses a preparation method of a sericin-gadolinium pH responsive targeting tumor nuclear magnetic resonance contrast agent. The contrast agent is used for enhancing MRI research of tumor tissues, sericin, gadolinium acetate hexahydrate and gadolinium chloride hexahydrate are adopted as raw materials, and the nano contrast agent SS@GAH-GdCl3 is synthesized through a Schiff base reaction. Amino groups of the sericin and aldehyde groups of the gadolinium acetate hexahydrate are subjected to aone-step reaction by a two-step method to form Schiff base, and gadolinium ions are supplemented through electrostatic adsorption of the gadolinium chloride hexahydrate. The contrast agent prepared by the method can smoothly pass through normal tissues and blood vessels, and the surface potential of the contrast agent can be automatically reversed at a tumor part to enter tumor tissues, so that the uptake of tumor cells is increased, and the precise MRI contrast of solid tumors is realized; and the metabolism time of the nano contrast agent is remarkably prolonged by 30-60 min, and is far longer than the pharmacokinetic time of a commercial gadodiamide injection.
Owner:SOUTHWEST UNIV

Knee osteoarthritis remote diagnosis and treatment system based on infrared imaging

ActiveCN109394180ASave time and moneyAvoid the possibility of subjective judgment errorDiagnostics using spectroscopySensorsNuclear medicineFemur
The invention relates to a knee osteoarthritis remote diagnosis and treatment system based on infrared imaging. The system comprises a detection room which is provided with a temperature control device, a timer, an angle calibrating component, a distance calibrating component, a marker and an infrared thermal imaging system, a computer, a thermal image processing module, a network and a diagnosisand treatment terminal, wherein the thermal image processing module is used for extracting position of the marker and taking the position as a reference, and the thermal image processing module is used for computing and extracting temperatures of the following five regions: medial tibial plateau 2cm*2cm region, lateral tibial plateau 2cm*2cm region, condylus medialis femoris 2cm*2cm region, condylus lateralis 2cm*2cm region and suprapatellar 2cm*1cm region; and by virtue of the network, results, which are extracted by the thermal image processing module, are transmitted to the diagnosis and treatment terminal, so that doctors can make out diagnosis furthermore. With the application of the remote diagnosis and treatment system provided by the invention, accurate knee joint skin temperaturevalues of patients with knee osteoarthritis can be remotely provided for doctor experts, so as to help the doctor experts to make diagnosis and treatment scheme early and to benefit patients.
Owner:SHUGUANG HOSPITAL AFFILIATED WITH SHANGHAI UNIV OF T C M

Reverse transcription-loop mediated isothermal amplification (RT-LAMP) quick detection method of citrus tristeza viruses (CTV)

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Biomarker OA (osteoactivin) for detecting postmenopausal osteoporosis and kit of biomarker OA

The invention provides an application of OA (osteoactivin) on the surfaces of peripheral blood CD14<+> mononuclear cells in preparation of a biomarker for detecting postmenopausal osteoporosis, and also provides a kit for detecting the postmenopausal osteoporosis. The kit contains a reagent for detecting OA on the surfaces of the peripheral blood CD14<+> mononuclear cells. According to the invention, early diagnosis molecules OA on the surface of the peripheral blood CD14<+> mononuclear cells of the postmenopausal osteoporosis are discovered and OA negatively regulates the molecular mechanismof RANKL<+>Th17 cells in abnormal activation of osteoclasts of the postmenopausal osteoporosis. Compared with imaging examination, the method for detecting the relative content of the OA on the surfaces of the peripheral blood CD14<+> mononuclear cells has the advantage that the postmenopausal osteoporosis can be rapidly, conveniently and accurately diagnosed in the early stage at the molecular level, so that not only can the postmenopausal osteoporosis of a patient be detected in the early stage, but also the patient can be prevented from receiving X-ray radiation in the bone mineral densitydetection process.
Owner:SHANGHAI CITY PUDONG NEW AREA GONGLI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products