Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

34results about How to "Early diagnosis is accurate" patented technology

Probe for diseases with amyloid accumulation, amyloid-staining agent, remedy and preventive for diseases with amyloid accumulation and diagnostic probe and staining agent for neurofibrillary change

The present invention provides compounds having high affinity for amyloid β-protein which are for the diagnosis of diseases in which amyloid β-protein accumulates, for agents for specifically staining amyloid β-protein, and for the treatment and / or prophylaxis of diseases in which amyloid β-protein accumulates. The present invention also provides probes and staining agents for neurofibrillary tangles.
Owner:BF RES INST

RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method

The invention discloses an RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and a detection method. The method comprises the steps of extracting plant viruses RNA, detecting an RT-LAMP reaction and electrophoresis detection or fluorochrome, and determining whether a plant carries the viruses. An RT-LAMP primer is designed according to a coat protein gene conserved region of CGMMV, and an RT-LAMP technology is adopted to establish a detection technology which can rapidly and sensitively detect the cucurbitaceous plant CGMMV such as cucumbers, watermelons and calabashes with high specificity and an application method thereof in diagnosing disease. The detection method provided by the invention can utilize the rapid extraction RNA and conventional RNA extraction as an RNA template for an RT-LAMP experiment. The method is utilized to rapidly identify a CGMMV plant sample, the targeted quarantine inspection protective measure is adopted, and the loss caused by the disease is reduced.
Owner:NANJING AGRICULTURAL UNIVERSITY

Methylated marker IL-2RG in systemic lupus erythematosus (SLE) whole blood genome and application thereof

The invention discloses a methylated marker IL-2RG in a systemic lupus erythematosus (SLE) whole blood genome and application thereof. The sequence of the marker is shown as SEQ ID NO:1. The methylated marker IL-2RG in the SLE whole blood genome is applied to the preparation of a reagent for diagnosing SLE, in particular to a kit for diagnosing SLE. By detecting the methylation level of the methylated marker IL-2RG, a specific methylation locus with a great meaning and a remarkable difference is counted and taken as a basis for early diagnosis of SLE. By adopting the methylated marker, an accurate, cheap and quick clinical tool for early diagnosis of SLE, the disease activity, the curative effect and the prognostic evaluation is provided.
Owner:CENT SOUTH UNIV

Artificial intelligence assisted prostate tumor early diagnosis method based on surface enhanced Raman spectroscopy

The invention discloses an artificial intelligence assisted prostate tumor early diagnosis method based on surface enhanced Raman spectroscopy. The method comprises the following steps of: collectinga serum sample; adopting a Raman spectrometer for detection; performing graphic analysis and data processing on an acquired Raman spectrum signal; selecting a biological tissue Raman spectrum concentration range of 400-1800cm<-1> for analysis, and preprocessing an original spectrum acquired by a spectrograph through Origin Pro 8 software, i.e. performing background reduction and spectrum area homogenization, drawing a serum average Raman spectrum, and then comparing changes and differences of related Raman characteristic peaks, thus finally obtaining a diagnosis result of prostate tumor earlydiagnosis. The method provided by the invention is higher in sensitivity and specificity, and unnecessary needle biopsy and missed diagnosis caused by an existing screening diagnosis method are reduced.
Owner:RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

Treatment of chemical diagnostic reagent unit testing target of breast cancer Her-2 immune tissue

A method for processing detected object of Her-2 immunohistochemistry diagnosis kit for breast cancer includes fixing human breast cancer tissue and carrying out antigenicity recovery treatment then staining it, utilizing biological character of high polymer PAMAM dendron shaped matter containing ammonia functional group to label reaction of antigen and antibody, using color former to make color display on it then observing detection result under microscope.
Owner:MAIDI BIOLOGICAL MEDICAL TECH SHENYANG

Schizophrenia biomarker combination based on intestinal flora and application and screening thereof

The invention discloses a schizophrenia biomarker combination based on intestinal flora and application. Whether candidate medicines can be used for treating or preventing schizophrenia or not can be determined by utilizing the influences of the candidate medicines on the biomarker before and after use. The defects that an existing schizophrenia diagnosis method cannot achieve early-stage pre-warning, cannot predict the pathogenesis and development tendency of schizophrenia and the like. Therefore, the schizophrenia biomarker combination can be applied to predicting the pathogenesis and development tendency of schizophrenia and applied to preparation and application of a kit for disease pathological typing.
Owner:THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV

Ulcerative colitis biomarker based on intestinal flora and application of ulcerative colitis biomarker

PendingCN110904213ADecreased structural diversityAccurate disease risk assessmentMicrobiological testing/measurementDrug actionGut flora
The invention provides an ulcerative colitis biomarker based on intestinal flora and application of the ulcerative colitis biomarker, and belongs to the technical field of biological medicines. The ulcerative colitis biomarker based on intestinal flora provided by the invention can overcome the defects that the existing ulcerative colitis diagnosis cannot realize early warning, cannot predict themorbidity and development trend and the like; and the ulcerative colitis biomarker based on intestinal flora can help pathological typing of diseases and research on drug action targets, precise medication, pathogenesis and the like, so that a high practical application value is achieved.
Owner:SHANDONG UNIV QILU HOSPITAL

Preparation method of sericin-gadolinium pH responsive targeting tumor nuclear magnetic resonance contrast agent

The invention belongs to the technical field of magnetic resonance imaging (MRI) contrast agents, and discloses a preparation method of a sericin-gadolinium pH responsive targeting tumor nuclear magnetic resonance contrast agent. The contrast agent is used for enhancing MRI research of tumor tissues, sericin, gadolinium acetate hexahydrate and gadolinium chloride hexahydrate are adopted as raw materials, and the nano contrast agent SS@GAH-GdCl3 is synthesized through a Schiff base reaction. Amino groups of the sericin and aldehyde groups of the gadolinium acetate hexahydrate are subjected to aone-step reaction by a two-step method to form Schiff base, and gadolinium ions are supplemented through electrostatic adsorption of the gadolinium chloride hexahydrate. The contrast agent prepared by the method can smoothly pass through normal tissues and blood vessels, and the surface potential of the contrast agent can be automatically reversed at a tumor part to enter tumor tissues, so that the uptake of tumor cells is increased, and the precise MRI contrast of solid tumors is realized; and the metabolism time of the nano contrast agent is remarkably prolonged by 30-60 min, and is far longer than the pharmacokinetic time of a commercial gadodiamide injection.
Owner:SOUTHWEST UNIV

Benzoxazole derivatives

It is intended to provide a benzoxazole derivative or a pharmaceutically acceptable salt or solvate thereof which is useful in the early diagnosis of a conformation disease; a composition or a kit containing the same for diagnosing a conformation disease; a medical composition for treating and / or preventing a conformation disease; and so on.
Owner:TOHOKU UNIV

Benzoxazole derivatives

It is intended to provide a benzoxazole derivative or a pharmaceutically acceptable salt or solvate thereof which is useful in the early diagnosis of a conformation disease; a composition or a kit containing the same for diagnosing a conformation disease; a medical composition for treating and / or preventing a conformation disease; and so on.
Owner:TOHOKU UNIV

Knee osteoarthritis remote diagnosis and treatment system based on infrared imaging

ActiveCN109394180ASave time and moneyAvoid the possibility of subjective judgment errorDiagnostics using spectroscopySensorsNuclear medicineFemur
The invention relates to a knee osteoarthritis remote diagnosis and treatment system based on infrared imaging. The system comprises a detection room which is provided with a temperature control device, a timer, an angle calibrating component, a distance calibrating component, a marker and an infrared thermal imaging system, a computer, a thermal image processing module, a network and a diagnosisand treatment terminal, wherein the thermal image processing module is used for extracting position of the marker and taking the position as a reference, and the thermal image processing module is used for computing and extracting temperatures of the following five regions: medial tibial plateau 2cm*2cm region, lateral tibial plateau 2cm*2cm region, condylus medialis femoris 2cm*2cm region, condylus lateralis 2cm*2cm region and suprapatellar 2cm*1cm region; and by virtue of the network, results, which are extracted by the thermal image processing module, are transmitted to the diagnosis and treatment terminal, so that doctors can make out diagnosis furthermore. With the application of the remote diagnosis and treatment system provided by the invention, accurate knee joint skin temperaturevalues of patients with knee osteoarthritis can be remotely provided for doctor experts, so as to help the doctor experts to make diagnosis and treatment scheme early and to benefit patients.
Owner:SHUGUANG HOSPITAL AFFILIATED WITH SHANGHAI UNIV OF T C M

Application of combined gene in esophageal squamous carcinoma

The invention relates to the technical field of biological medicines, and discloses an application of a combined gene in preparation of a product for diagnosing esophageal squamous carcinoma. The combined gene comprises the following genes of a CCL20 gene, a GSTP1 gene, an HSPB1 gene, a KRT14 gene, a KRT15 gene, an S100A8 gene, an S100A9 gene and a TACSTD2 gene. The invention also discloses an application of the combined gene in preparation of a pharmaceutical composition for treating the esophageal squamous carcinoma. Compared with single gene expression detection of the esophageal squamous carcinoma in the prior art, the combined gene has higher specificity and higher diagnosis efficiency, can significantly improve the detection sensitivity and specificity, can accurately, conveniently and efficiently perform esophageal squamous carcinoma early diagnosis and large-scale screening, and fills up the blank of an existing diagnosis technology, so that effective treatment measures are provided for esophageal squamous carcinoma patients in time, and prognosis is improved.
Owner:WEST CHINA HOSPITAL SICHUAN UNIV

LAMP primer combination for detecting Bombyx mori nuclear polyhedrosis virus and kit

InactiveCN105803117ARapid early diagnosisEarly diagnosis is accurateMicrobiological testing/measurementDNA/RNA fragmentationBombyx mori nuclear polyhedrosis virusTissue sample
The invention discloses an LAMP primer combination for detecting Bombyx mori nuclear polyhedrosis virus and a kit. The primer combination comprises external primers, internal primers and a loop primer, wherein the external primers F3 and B3, the internal primers FIP and BIP and the loop primer LF have base sequences of a sequence list from SEQ.ID.No.1 to SEQ.ID.No.5. The primer combination is contained in the kit. By means of the LAMP primer combination for detecting Bombyx mori nuclear polyhedrosis virus and the kit, Bombyx mori nuclear polyhedrosis virus can be detected only by performing DNA extraction and loop-mediated isothermal amplification on a tissue sample, thus early diagnosis of Bombyx mori nuclear polyhedrosis virus in a production field can be carried out quickly, accurately and easily. Compared with the prior art, the LAMP primer combination for detecting Bombyx mori nuclear polyhedrosis virus and the kit have the advantages of high specificity, high sensitivity, quick result obtaining and no pollution.
Owner:GUANGXI UNIV

Pet probe having an alkoxy group substituted by fluorine and hydroxy group

InactiveUS20100272642A1Improve securityLow and no bone accumulationBiocideNervous disorderDiseaseAlkoxy group
Disclosed are: a PET probe compound having an alkoxy group substituted by a fluorine and a hydroxy group, which is useful for the early diagnosis of a conformational disease; a pharmaceutical composition for the treatment and / or prevention of a conformational disease, which comprises the compound; and others.
Owner:TOHOKU UNIV

Asthma biomarker and application thereof

The invention relates to the field of biomedicine and particularly relates to an asthma biomarker and application thereof. The biomarker for asthma or related diseases comprises at least one of Bacterodies stercoris and / or analogue thereof, Eggerthella lenta and / or analogue thereof and Sutterella wadsworthensis and / or analogue thereof. The biomarker for early diagnosis of asthma or related diseases and a method for diagnosing asthma or related diseases and predicting the risk of illness can overcome the defect that an existing asthma diagnosing method cannot achieve early warning or predict pathogenesis of asthma and the like.
Owner:SHENZHEN HUADA GENE INST

Migraine biomarker and use thereof

The present invention relates to the field of biomedicines and particularly relates to a migraine biomarker and an application thereof. The provided migraine biomarker comprises at least one selectedfrom the following: bacteroides thetaiotaomicron and / or analogues thereof, faecalibacterium prausnitzii and / or analogues thereof, bacteroides intestinalis and / or analogues thereof and anaeroridus colihominis and / or analogues thereof. The present invention provides the biomarker for early diagnosis of the migraine, and a diagnosis and disease risk assessment method of the migraine, and can solve problems that the existing migraine diagnosis method cannot conduct early warn, cannot predict migraine attack, etc.
Owner:SHENZHEN HUADA GENE INST

Kit for early diagnosis of Alzheimer's disease and application thereof

The invention relates to the technical field of biological detection, in particular to a kit for early diagnosis of Alzheimer's disease and application of the kit. According to the kit, the purpose of early diagnosis of the Alzheimer's disease is achieved through combined detection of T-tau, p-Tau-181, p-Tau-217 and p-Tau-231 in serum and plasma. The kit is wide in detection range, high in sensitivity and good in precision, is suitable for a full-automatic chemiluminiscence instrument, is simple to operate, is suitable for the requirement of clinically detecting a large amount of serum and plasma, and provides more accurate and more personalized guidance opinions for early diagnosis of Alzheimer's disease.
Owner:SHANDONG UNIV QILU HOSPITAL +1

Cervical cancer cytology artificial intelligence screening method and device

The invention discloses a cervical cancer cytology artificial intelligence screening method and a cervical cancer cytology artificial intelligence screening device, which are characterized in that dropped cervical cancer cells are collected, a base fluid thin layer (TCT) manufacturing technology is used for preparing the dropped cervical cancer cells into a TCT slide, a microscope automatic scanner is used for scanning the TCT slide one by one to form a digital picture, and the digital picture is used for screening the cervical cancer cells. And identifying and marking the cervical cancer cells on the digital picture by using an artificial intelligence method and device, and giving a diagnosis result. According to the technical scheme, a simple, convenient and effective method for early detection of cervical cancer through cervical cancer cell shedding and artificial intelligence is provided, the cervical cancer can be early detected, the medical cost is reduced, and the cure rate is increased.
Owner:苏州赫米兹健康科技有限公司 +1

Reverse transcription-loop mediated isothermal amplification (RT-LAMP) quick detection method of citrus tristeza viruses (CTV)

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.
Owner:CITRUS RES INST OF CHINESE ACAD OF AGRI SCI

Hepatocellular carcinoma marker and detection kit

The invention provides a new hepatocellular carcinoma marker and a detection kit. Early diagnosis can be performed on liver cancer more efficiently and accurately based on the marker, the tissue demand is small, the detection time is short, the detection accuracy is high, the operation method is simple, and the cost is lower. More importantly, the interaction of liver cancer and liver cancer immune microenvironment is comprehensively considered, and good reference and evaluation indexes are provided for further treatment strategies of liver cancer patients, such as immunotherapy selection targeting innate immune cells or targeting T lymphocytes, while the liver cancer early diagnosis marker is provided. The hepatocellular carcinoma marker and the detection kit have high reference value forearly diagnosis and immunotherapy selection of liver cancer, and are suitable for popularization and application.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Coronary heart disease patient-specific biomarker composition and use thereof

A disease-specific metabolite profile is provided, in particular to a biomarker composition screened from the plasma-specific metabolite profile of patients with coronary heart disease. As well as the use of the biomarker composition for risk assessment, diagnosis, early diagnosis and pathological staging of coronary heart disease, and methods for risk assessment, diagnosis, early diagnosis and pathological staging of coronary heart disease. The provided biomarker composition can be used for early diagnosis of coronary heart disease, has high sensitivity and good specificity, and has good application prospects.
Owner:BGI SHENZHEN CO LTD +1

Chytrid LAMP rapid detection method and kit

The invention discloses a chytrid LAMP rapid detection method and a kit, and belongs to the field of application of agriculture science biotechnology. The rapid detection method comprises the following steps: (1) extracting total DNA nucleic acid of a to-be detected sample as a reaction template; (2) preparing an LAMP reaction solution according to the solution 1: solution 2: solution 3 volume ratio of 1:1:3; (3) adding the sample total DNA extracted in the step (1) into the LAMP reaction solution prepared in the step (2) and mixing; (4) reacting at water bath with a constant temperature of 62 DEG C for 30 min; and (5) obtaining the diagnosis result, namely employing electrophoresis detection or fluorescence dye technology to perform identification on the product of amplification reaction in the step (4). The method has the advantages of simple operation, low cost, rapid reaction, high specificity and high sensitivity, and is short in consumed time, has the sensitivity higher than that of common PCR by 100 times, and has the characteristics of relatively high accuracy on early-stage diagnosis on chytrid.
Owner:NORTHEAST FORESTRY UNIVERSITY

Lamp rapid detection method and kit for chytrid fungus

The invention discloses a chytrid LAMP rapid detection method and a kit, and belongs to the field of application of agriculture science biotechnology. The rapid detection method comprises the following steps: (1) extracting total DNA nucleic acid of a to-be detected sample as a reaction template; (2) preparing an LAMP reaction solution according to the solution 1: solution 2: solution 3 volume ratio of 1:1:3; (3) adding the sample total DNA extracted in the step (1) into the LAMP reaction solution prepared in the step (2) and mixing; (4) reacting at water bath with a constant temperature of 62 DEG C for 30 min; and (5) obtaining the diagnosis result, namely employing electrophoresis detection or fluorescence dye technology to perform identification on the product of amplification reaction in the step (4). The method has the advantages of simple operation, low cost, rapid reaction, high specificity and high sensitivity, and is short in consumed time, has the sensitivity higher than that of common PCR by 100 times, and has the characteristics of relatively high accuracy on early-stage diagnosis on chytrid.
Owner:NORTHEAST FORESTRY UNIVERSITY

Nested PCR detection kit for pine wood nematode disease and use method thereof

ActiveCN113215288ARapid molecular identificationRapid early diagnosisMicrobiological testing/measurementBiotechnologyDisease
The invention discloses a nested PCR detection kit for pine wood nematode disease and a use method thereof. The kit comprises (1) TSINGKE gold brand Mix (green); (2) primers: 10mmol / L TLP-W-S, 10mmol / L TLP-W-A, 10mmol / L TLP-N-S and 10mmol / L TLP-N-A, wherein the sequence of the primer TLP-W-S is 5'AGACCCTCATTCTTGCC-3', the sequence of the primer TLP-W-A is 5'-GGACAGTAGATGACGTAGAAT-3', the sequence of the primer TLP-N-S is 5'-CGGTATCGGATGTGCTATT-3', and the sequence of the primer TLP-N-A is 5'-CAAGGACAGTAGATGACGTAGAAT-3'; (3) lysate (A liquid); (4) protease K (B liquid); (5) ddH2O; and (6) positive control Y liquid. The kit can quickly and accurately identify pine wood nematode molecules and early diagnose the pine wood nematode disease, and has great significance for controlling quarantine of the pine wood nematode disease and preventing and treating diseases.
Owner:SICHUAN AGRI UNIV

Screening of polycystic ovarian syndrome intestinal flora biomarker and application thereof

The invention discloses a polycystic ovarian syndrome (PCOS) biomarker combination based on intestinal flora. The polycystic ovarian syndrome (PCOS) biomarker combination is applied to polycystic ovarian syndrome intestinal flora detection, polycystic ovarian syndrome disease risk prediction and polycystic ovarian syndrome prognosis monitoring. The polycystic ovarian syndrome biomarker combination based on intestinal flora is characterized by comprising the following components: 1) a biomarker 1: Ruminococcus_bromii; a biomarker 2: Gordonibacterium_pamelaeae; a biomarker 3: Eesulfovibrio_piger; a biomarker 4: Eubacterium_ventriosum, and a biomarker 5: Prevotella_stercorea; and 2) a polycystic ovarian syndrome biomarker combination diagnosis model based on the intestinal flora has the advantages of high sensitivity, strong specificity and simple result judgment.
Owner:GUANGDONG HOSPITAL OF TRADITIONAL CHINESE MEDICINE

RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method

The invention discloses an RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and a detection method. The method comprises the steps of extracting plant viruses RNA, detecting an RT-LAMP reaction and electrophoresis detection or fluorochrome, and determining whether a plant carries the viruses. An RT-LAMP primer is designed according to a coat protein gene conserved region of CGMMV, and an RT-LAMP technology is adopted to establish a detection technology which can rapidly and sensitively detect the cucurbitaceous plant CGMMV such as cucumbers, watermelons and calabashes with high specificity and an application method thereof in diagnosing disease. The detection method provided by the invention can utilize the rapid extraction RNA and conventional RNA extraction as an RNA template for an RT-LAMP experiment. The method is utilized to rapidly identify a CGMMV plant sample, the targeted quarantine inspection protective measure is adopted, and the loss caused by the disease is reduced.
Owner:NANJING AGRICULTURAL UNIVERSITY

DNA methylation biomarkers for early detection of cervical cancer

The present invention discloses an in vitro method for obtaining DNA methylation biomarkers as exquisite DNA methylation positions in the human genome (i.e., CGIDs) that predict cervical cancer especially at as yet inaccessible early stages by examining progression of “categorical” DNA methylation alterations in three stages of premalignant lesions (cervical intraepithelial neoplasia (CIN)), progressing from CIN1 to CIN3. The present invention discloses combinations of CGIDs for detecting with high specificity and sensitivity cervical cancer by measuring their DNA methylation status and deriving a “methylation score”, which is useful as a biomarker for cervical cancer. Also disclosed are kits for predicting cervical cancer using such CGIDs using multiplexed next generation sequencing methylation assays, pyrosequencing assays and methylation specific PCR. The DNA methylation markers (CGIDs) described in the present invention are useful for cervical screening and early detection of cervical cancer by any person skilled in the art to detect cervical cancer.
Owner:HKG EPITHERAPEUTICS LTD

Biomarker OA (osteoactivin) for detecting postmenopausal osteoporosis and kit of biomarker OA

The invention provides an application of OA (osteoactivin) on the surfaces of peripheral blood CD14<+> mononuclear cells in preparation of a biomarker for detecting postmenopausal osteoporosis, and also provides a kit for detecting the postmenopausal osteoporosis. The kit contains a reagent for detecting OA on the surfaces of the peripheral blood CD14<+> mononuclear cells. According to the invention, early diagnosis molecules OA on the surface of the peripheral blood CD14<+> mononuclear cells of the postmenopausal osteoporosis are discovered and OA negatively regulates the molecular mechanismof RANKL<+>Th17 cells in abnormal activation of osteoclasts of the postmenopausal osteoporosis. Compared with imaging examination, the method for detecting the relative content of the OA on the surfaces of the peripheral blood CD14<+> mononuclear cells has the advantage that the postmenopausal osteoporosis can be rapidly, conveniently and accurately diagnosed in the early stage at the molecular level, so that not only can the postmenopausal osteoporosis of a patient be detected in the early stage, but also the patient can be prevented from receiving X-ray radiation in the bone mineral densitydetection process.
Owner:SHANGHAI CITY PUDONG NEW AREA GONGLI HOSPITAL

A remote diagnosis and treatment system for knee osteoarthritis based on infrared imaging

The invention relates to a remote diagnosis and treatment system for knee osteoarthritis based on infrared imaging, which includes a detection room equipped with a temperature control device, a timer, an angle calibration component, a distance calibration component, markers, an infrared thermal imager, a computer, and a thermal image Processing module, network and diagnosis and treatment terminal; the thermal image processing module is used to extract the position of the marker and use this as a reference to calculate and extract the temperature of the following five areas: medial tibial plateau 2cm×2cm area, lateral tibial plateau 2cm×2cm region, medial femoral condyle 2cm×2cm region, lateral femoral condyle 2cm×2cm region, and suprapatellar 2cm×1cm region; the network transmits the results extracted by the thermal image processing module to the diagnosis and treatment terminal so that doctors can make further diagnoses. The invention can remotely provide doctors and experts with accurate knee joint skin temperature values ​​for patients with knee osteoarthritis, so as to help doctors and experts make early diagnosis and formulate treatment plans, and benefit patients.
Owner:SHUGUANG HOSPITAL AFFILIATED WITH SHANGHAI UNIV OF T C M
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More