Reverse transcription-loop mediated isothermal amplification (RT-LAMP) quick detection method of citrus tristeza viruses (CTV)
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] Below in conjunction with specific embodiment the present invention is described in further detail:
[0044] The invention provides a rapid detection method of citrus decay virus RT-LAMP. According to the gene sequences of different strains of citrus decay virus (CTV) published by GenBank, 4 RT-LAMP-specific primers (sequences below) of CTV were designed for the relatively conserved region of the sequence of citrus decay virus (CTV). The strain was used as a template, and an RT-LAMP method that could detect all citrus decay viruses was established. Diagnosis is then based on the electropherogram.
[0045] Primer design:
[0046] The conserved sequence of CTV and the specific primer sequence designed for RT-LAMP:
[0047]
[0048] F3: cgaagtggatttgtctgaca
[0049] B3: ggaatccctgcatctagcg
[0050] FIP: actcgaagggcgttagtacggctttggactgacgtcgtgtt
[0051] BIP: ctggggtagactaacgatgccgacgtccgccataactcaa
[0052] The specific detection method steps are:
[0053] 1) Extr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
