Industrialized gene synthesis method
A gene synthesis and oligonucleotide technology, applied in the field of genetic engineering, can solve the problems of inability to use long gene, whole gene or gene combination, low success rate of long DNA sequence synthesis, complicated oligonucleotide chain design, etc. Short synthesis cycle, high success rate, simple design effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0093] After the oligonucleotide chain is designed, it can be synthesized by using an ordinary oligonucleotide automatic synthesizer. The chemical synthesis method of existing oligonucleotide chain comprises: phosphodiester method, phosphotriester method, phosphite triester method, solid-phase synthesis method, automatic method and the latest gene chip method etc., described gene The chip method is the latest method of gene synthesis. At present, the in situ synthesis method of the gene chip is used, which refers to the chip prepared by directly combining multiple oligonucleotide fragments with a single nucleotide substrate to a specific position of the carrier. Including photochemical gene chip synthesis method, physical method, mechanical method, microfluidic method, etc. However, most of this method is still in the research and development and experimental stages, and the synthesized gene fragments are relatively short. At present, the solid-phase phosphoramidite triester ...
Embodiment 1
[0142] The target synthetic product of this example is the FucT2 (Helicobacter pylori fucosyltransferase B) gene sequence with a length of 926 bases, which is connected to the vector pUC57. The Fuct2 gene contains highly mutated sequences (poly (C) and TAA repeats), which can often move into or out of the coding frame through the mechanism of polymerase delay, and express human carcinoembryonic antigen LewisY protein. The synthetic FucT2 gene can be used in the analysis and research of anti-cancer.
[0143] The gene synthesis process of the present embodiment is as follows:
[0144] 1. The DNA sequence of the target DNA sequence after sequence analysis and optimization by bioinformatics gene work and other gene design software is as follows:
[0145] 5′-ACAGGTTGACGCTATGGCTTTTAAAGTGGTGCAAATTTGTGGGGGGCTTGGGAATCAAATGTTTCAATACGCTTTCGCTAAAAGTTTGCAAAAACACCTTAATACGCCCGTGCTATTAGACACTACTTCTTTTGATTGGAGCAATAGGAAAATGCAATTAGAGCTTTTCCCTATTGATTTGCCCTATGCGAATGCAAAAGAAATCGCTATAGCTAAAATGCAACAT...
Embodiment 2
[0162] The target synthetic product of this example is the catalytic subunit P110-alpha of phosphatidylinositol kinase (PI3K), the sequence of the gene length is 3230 bases, and it is connected to the vector pLVX- Tight-puro on. The catalytic subunit of P110-alpha phosphatidylinositol kinase (PI3K), the expression of p110-alpha protein in CHO cells can fully activate the promoter c-fos, an important component of serum response. The constructed recombinant will be used to transfect yeast cells to analyze the effect of protein P110-alpha.
[0163] The gene synthesis process of the present embodiment is as follows:
[0164] 1. The DNA sequence of the target sequence after sequence analysis and optimization by gene design software such as bioinformatics gene work is as follows:
[0165] 5′-GGATCCGCCGCCACCATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATCCTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCAT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap