Unlock instant, AI-driven research and patent intelligence for your innovation.

Industrialized gene synthesis method

A gene synthesis and oligonucleotide technology, applied in the field of genetic engineering, can solve the problems of inability to use long gene, whole gene or gene combination, low success rate of long DNA sequence synthesis, complicated oligonucleotide chain design, etc. Short synthesis cycle, high success rate, simple design effect

Active Publication Date: 2012-01-18
GENEWIZ INC SZ
View PDF1 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method uses multiple DNA oligonucleotide chains to react under the same conditions, which simplifies the operation and reduces the cost, but there are many shortcomings, such as complex design of oligonucleotide chains, and multi-step reactions of multiple enzymes at the same time leading to splicing. The efficiency is low, the success rate of long DNA sequence synthesis is low, and the yield of gene synthesis is small, so it cannot be directly used for downstream operations, such as cloning and ligation reactions, etc., must be subjected to PCR amplification, etc., so it cannot be used for longer genes and whole genes or genome synthesis, which is more difficult to promote in actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Industrialized gene synthesis method
  • Industrialized gene synthesis method
  • Industrialized gene synthesis method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0093] After the oligonucleotide chain is designed, it can be synthesized by using an ordinary oligonucleotide automatic synthesizer. The chemical synthesis method of existing oligonucleotide chain comprises: phosphodiester method, phosphotriester method, phosphite triester method, solid-phase synthesis method, automatic method and the latest gene chip method etc., described gene The chip method is the latest method of gene synthesis. At present, the in situ synthesis method of the gene chip is used, which refers to the chip prepared by directly combining multiple oligonucleotide fragments with a single nucleotide substrate to a specific position of the carrier. Including photochemical gene chip synthesis method, physical method, mechanical method, microfluidic method, etc. However, most of this method is still in the research and development and experimental stages, and the synthesized gene fragments are relatively short. At present, the solid-phase phosphoramidite triester ...

Embodiment 1

[0142] The target synthetic product of this example is the FucT2 (Helicobacter pylori fucosyltransferase B) gene sequence with a length of 926 bases, which is connected to the vector pUC57. The Fuct2 gene contains highly mutated sequences (poly (C) and TAA repeats), which can often move into or out of the coding frame through the mechanism of polymerase delay, and express human carcinoembryonic antigen LewisY protein. The synthetic FucT2 gene can be used in the analysis and research of anti-cancer.

[0143] The gene synthesis process of the present embodiment is as follows:

[0144] 1. The DNA sequence of the target DNA sequence after sequence analysis and optimization by bioinformatics gene work and other gene design software is as follows:

[0145] 5′-ACAGGTTGACGCTATGGCTTTTAAAGTGGTGCAAATTTGTGGGGGGCTTGGGAATCAAATGTTTCAATACGCTTTCGCTAAAAGTTTGCAAAAACACCTTAATACGCCCGTGCTATTAGACACTACTTCTTTTGATTGGAGCAATAGGAAAATGCAATTAGAGCTTTTCCCTATTGATTTGCCCTATGCGAATGCAAAAGAAATCGCTATAGCTAAAATGCAACAT...

Embodiment 2

[0162] The target synthetic product of this example is the catalytic subunit P110-alpha of phosphatidylinositol kinase (PI3K), the sequence of the gene length is 3230 bases, and it is connected to the vector pLVX- Tight-puro on. The catalytic subunit of P110-alpha phosphatidylinositol kinase (PI3K), the expression of p110-alpha protein in CHO cells can fully activate the promoter c-fos, an important component of serum response. The constructed recombinant will be used to transfect yeast cells to analyze the effect of protein P110-alpha.

[0163] The gene synthesis process of the present embodiment is as follows:

[0164] 1. The DNA sequence of the target sequence after sequence analysis and optimization by gene design software such as bioinformatics gene work is as follows:

[0165] 5′-GGATCCGCCGCCACCATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATCCTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an industrialized gene synthesis method. The industrialized gene synthesis method comprises the following steps of (1) analyzing and optimizing a DNA sequence for synthesis to obtain a target DNA sequence; (2) designing an oligodeoxynucleotide chain for extension according to the target DNA sequence; (3) synthesizing and purifying the oligodeoxynucleotide chain; (4) splicing the oligodeoxynucleotide chain to form a DNA fragment; (5) cloning the DNA fragment to a vector to obtain a recombinant plasmid; (6) carrying out sequencing analysis of the recombinant plasmid; and(7) carrying out a quality validation process on the recombinant plasmid with a correct sequence. The industrialized gene synthesis method has the characteristics of high success rate, high throughput, high speed, low cost, simple design, wide application scope and standardized operation. Therefore, the industrialized gene synthesis method has feasibility of industrial scale popularization, and is beneficial for reduction of costs, shortening of a synthesis cycle and improvement of synthesis quality.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a gene synthesis method suitable for industrial production. Background technique [0002] As one of the basic technologies of molecular biology operations, molecular cloning has been successfully used for more than 20 years. It is a necessary means for scientists to carry out gene cloning, detection, functional research and recombinant expression, and has played a revolutionary role in the development of bioengineering. effect. Today, with the rapid development of the gene era, traditional molecular cloning technology can no longer meet the efficient and accurate gene manipulation requirements required by researchers, and the emergence of gene synthesis technology is filling this gap and becoming an important technical means for obtaining target genes. Using gene synthesis to obtain the target gene can not only obtain the gene sequence that does not exist in nature or has a ve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
Inventor 柳伟强杨平刁文一张万方孙中平廖国娟
Owner GENEWIZ INC SZ