Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Structure, preparation method and purpose of anti-influenza virus oligonucleotide

An oligonucleotide, influenza virus infection technology, applied in the direction of antiviral agents, sugar derivative preparation, chemical instruments and methods, etc., to achieve important social and economic benefits.

Inactive Publication Date: 2012-02-15
INST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although rimantadine is currently a good anti-influenza virus drug, the antigenic drift of influenza virus makes it resistant to rimantadine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Structure, preparation method and purpose of anti-influenza virus oligonucleotide
  • Structure, preparation method and purpose of anti-influenza virus oligonucleotide
  • Structure, preparation method and purpose of anti-influenza virus oligonucleotide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] This example mainly illustrates the synthesis of PROP5 modified by rimantadine and aliphatic chains and its research on the inhibition of CPE activity induced by H1N1 and H3N2 at the level of A549 cells or MDCK cells in vitro.

[0036] Materials and Methods

[0037] 1. Design and synthesis of oligonucleotide PROP5

[0038] Retrieve the nucleic acid sequence database in GeneBank, select the PDCD5 mRNA reference sequence NM_004708.2 published by NCBI, and perform computer simulation of the RNA secondary structure, and select 5 unstable stem-loop structures as antisense oligonucleotides target. By comparing with the GeneBank online blast sequence, the selected target sequence has good specificity and will not interfere with the expression of other normal human genes. The target position on the gene is 151-170, and the sequence is named PROP5. Its sequence is 5'CCCTGTGCTTTGCTTCCTGT3'. Oligonucleotides were synthesized by 8909 type automatic DNA synthesizer to synthesize ...

Embodiment 2

[0084] This example mainly illustrates the design, synthesis and verification of promoting cell uptake efficiency of anti-influenza virus antisense oligonucleotide (PROP5) rimantadine-modified fluorescent marker (FAM) label targeting human PDCD5 gene.

[0085] Materials and Methods

[0086] 1. A549 cells

[0087] A549 cell culture medium is F12K culture medium containing 10% fetal bovine serum (Gibco), adhered to the logarithmic growth phase, digested with trypsin to collect cells, paved 6-well culture plate, adhered to the culture to 70% cell confluence Drugs are tested. The culture condition of cell incubation is 5% concentration CO 2 , 37°C, use a maintenance solution containing 1% fetal bovine serum and 5mg / ml trypsin when adding drugs.

[0088] 2. Coupling of rimantadine and PROP5 and fluorescein modification

[0089] Referring to the materials and methods 1 and 2 of the examples, the optimized synthesis route and the reaction conditions of each step were used to synt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a structure and purpose of an anti-influenza virus oligonucleotide. Specifically, provided is a structure, a preparation method and purpose of an anti-influenza virus (IV) antisense oligonucleotide of a targeting anti virus programmed cell death protein (PDCD5) which is modified by rimantadine or aliphatic chain. The laboratory utilizes a chemical synthesis method to couple rimantadine or aliphatic chain on a screened anti influenza antisense sequence; an RS-HPLC shows that electronegativity and polarity of the antisense sequence are lowered; a fluorescent labeling method has proved on an A549 cell that the modification promotes absorption of the antisense sequence by the cell; and it is found on an A549 cell and an MDCK cell that the modification can enhance antisense sequence activities on resisting cytopathic effect caused by influenza A viruses H1N1 and H3N2 and ethylamine drug resistant strain H3N2. Therefore, the invention relates to a novel nucleic acid medicament improvement method, which utilizes chemical modification to reduce nucleic acid medicament polarity, increase nucleic acid medicament bioavailability, reduce drugs dose and enhance antiviral curative effect.

Description

technical field [0001] The present invention relates to the field of bioengineering medicine and the field of organic synthesis, in particular to an oligonucleotide (ASODN) targeting programmed cell death factor 5 (PDCD5, Programmed cell deathprotein 5) for treating influenza virus (IV, influenza virus) infection , antisense oligodexynucleotide) sequence drug new structure, modification method and its therapeutic drug. Background technique [0002] Influenza virus infection can cause acute respiratory infectious diseases. The disease has a short incubation period, is highly contagious, and spreads rapidly. Influenza A is the most threatening, and it is prone to mutation, which can easily cause outbreaks. From 1918 to 1920, the famous "Spanish flu" caused 20-40 million deaths worldwide. Since then, "Asian flu" caused by influenza A virus (H2N2) in 1957, "Hong Kong flu" caused by influenza A virus (H3N2) in 1968, and "Russian flu" caused by influenza A virus (H1N1) in 1977 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07H21/04C07H1/00A61K47/48A61K48/00A61P31/16
Inventor 王升启赵海豹杨静张京玉丁晓然周喆钟芝茵刘娟鲁丹丹
Owner INST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com