Structure, preparation method and purpose of anti-influenza virus oligonucleotide
An oligonucleotide, influenza virus infection technology, applied in the direction of antiviral agents, sugar derivative preparation, chemical instruments and methods, etc., to achieve important social and economic benefits.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] This example mainly illustrates the synthesis of PROP5 modified by rimantadine and aliphatic chains and its research on the inhibition of CPE activity induced by H1N1 and H3N2 at the level of A549 cells or MDCK cells in vitro.
[0036] Materials and Methods
[0037] 1. Design and synthesis of oligonucleotide PROP5
[0038] Retrieve the nucleic acid sequence database in GeneBank, select the PDCD5 mRNA reference sequence NM_004708.2 published by NCBI, and perform computer simulation of the RNA secondary structure, and select 5 unstable stem-loop structures as antisense oligonucleotides target. By comparing with the GeneBank online blast sequence, the selected target sequence has good specificity and will not interfere with the expression of other normal human genes. The target position on the gene is 151-170, and the sequence is named PROP5. Its sequence is 5'CCCTGTGCTTTGCTTCCTGT3'. Oligonucleotides were synthesized by 8909 type automatic DNA synthesizer to synthesize ...
Embodiment 2
[0084] This example mainly illustrates the design, synthesis and verification of promoting cell uptake efficiency of anti-influenza virus antisense oligonucleotide (PROP5) rimantadine-modified fluorescent marker (FAM) label targeting human PDCD5 gene.
[0085] Materials and Methods
[0086] 1. A549 cells
[0087] A549 cell culture medium is F12K culture medium containing 10% fetal bovine serum (Gibco), adhered to the logarithmic growth phase, digested with trypsin to collect cells, paved 6-well culture plate, adhered to the culture to 70% cell confluence Drugs are tested. The culture condition of cell incubation is 5% concentration CO 2 , 37°C, use a maintenance solution containing 1% fetal bovine serum and 5mg / ml trypsin when adding drugs.
[0088] 2. Coupling of rimantadine and PROP5 and fluorescein modification
[0089] Referring to the materials and methods 1 and 2 of the examples, the optimized synthesis route and the reaction conditions of each step were used to synt...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com