Modified mcry2Ab4 gene and its application

A technology of pet-2ab4 and gene, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as low protein expression, weak insect resistance, and difference in codon usage frequency

Inactive Publication Date: 2012-03-28
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the insect resistance of these early Bt transgenic plants is very weak, it is difficult to detect mRNA transcription, and the protein expression level is very low
There are many reasons for the low expression of Bt genes in plants: for example, 1. The wild Bt gene is rich in AZ sequences, and the mRNA expressed in plants is unstable; 2. There may be eukaryotic gene inclusion in the wild Bt gene cleavage sites and ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified mcry2Ab4 gene and its application
  • Modified mcry2Ab4 gene and its application
  • Modified mcry2Ab4 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Design and synthesis of new vip3Aa11 and cry2Ab4 gene (DNA) sequences and preparation methods thereof.

[0054] (1) Find the codons preferred by plants such as cotton, and while keeping the amino acid composition of the original Vip3Aa11 and Cry2Ab4 insecticidal proteins unchanged, replace the codons corresponding to the vip3Aa11 and cry2Ab4 genes with the codons preferred by the plant genes to obtain preliminary results Modified DNA sequence.

[0055] (2) Exclude AT-rich sequences and commonly used restriction endonuclease sites in the DNA sequence that cause the instability of plant gene transcripts, and then correct and eliminate them by replacing codons.

[0056] (3) Use computer software (DNAman) to analyze and eliminate large inverted repeats in genes by replacing codons.

[0057] (4) Add restriction enzyme recognition site sequences required for further cloning at both ends of the sequence.

[0058] (5) Determine the coding sequence of mvip3Aa11 gene as shown i...

Embodiment 2

[0084] Example 2: Expression, purification and insecticidal activity verification of optimized new genes mvip3Aa11 and mcry2Ab4 in E. coli

[0085] 1) Expression and purification of Cry2Ab4:

[0086] Analyzing the mcry2Ab4 gene sequence, designing a pair of primers based on the E. coli T7 expression vector pET21b cloning site, and introducing BamHI and EcoRI restriction sites on the two primers. A primer pair (2abup: CGC GGATCCGATGAATAGTGTATTGAATAGC / 2abdown CCG GAATTC AAACTTTAATAAAGTGGTG) was used to amplify the mcry2Ab4 gene, and the template was pUCCRY2AB. Amplification was performed according to the following parameters: 94°C pre-denaturation for 3 min; 94°C denaturation for 1 min; 53°C annealing for 1 min; 72°C extension for 3 min, 32 cycles; finally 72°C extension for 10 min. The polymerase is PFU polymerase.

[0087] The full-length cry2Ab4 gene was amplified by BamHI and EcoRI. The PCR product and vector pET-21b were digested with BamHI and EcoRI. After recovery, the PCR p...

Embodiment 3

[0090] Example 3: Vip3Aa11 and Cry2Ab4 protein insecticidal activity verification and synergy analysis:

[0091] The Vip3Aa11 and Cry2Ab4 proteins expressed and purified in Escherichia coli were tested for their separate insecticidal activity and the combined use of 1:1 to determine the synergistic coefficient of the two proteins. The results showed that the combined use of the two proteins and the use of the two proteins alone had significant insecticidal effects on the cotton bollworm susceptible strain 96S and the resistant strain BtR. In the results using mortality as the evaluation standard (Table 4, showing the results of the synergy of the mortality measurement method), the synergistic values ​​of the protein combination on the sensitive and resistant populations were 117.44% and 199.82, respectively, synergistically. The effect is remarkable. In the results of the evaluation standard based on the weight inhibition rate (Table 5, showing the results of the weight inhibiti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a modified mcry2Ab4 gene and its application, and belongs to the technical field of biological control. The modified mcry2Ab4 gene encodes a protein with an amino acid sequence as shown in SEQ ID NO4. The nucleotide sequence is as shown in SEQ ID NO3. By regulating the nucleotide composition of cry2Ab4 gene, its codon frequency is similar to that of a plant gene without changing the encoding amino acid sequence, and the modified gene composition is expressed in plant so as to obtain the resistance to lepidoptera insects.

Description

[0001] This application is a divisional application with the patent application number "2009102420406" and the invention title "modified Bt genes mvip3Aa11, mcry2Ab4, and their gene combinations and applications". Technical field [0002] The invention belongs to the technical field of biological control, and particularly relates to gene combinations for expressing high virulence proteins to lepidopteran pests, artificially synthesized sequences and applications thereof. Background technique [0003] Insect pests are one of the important factors causing agricultural production losses. According to statistics, the direct economic loss caused by insect pests to agricultural production is as high as 15% every year. Chemical pesticides have made important contributions to pest control and stable agricultural production. With the increasing awareness of the environmental hazards of chemical pesticides and the increasing awareness of environmental protection, in order to realize the su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/32C07K14/325A01P7/04C12N15/70C12N15/84C12N1/21A01H5/00C12R1/07C12R1/19
Inventor 张杰郎志宏梁革梅宋福平束长龙黄大昉
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap