Human paraoxonase (PON) 2 gene 148 site G/A polymorphic detection kit
A gene polymorphism and kit technology, applied in the field of identifying human PON2 gene polymorphism rs12026, can solve the problems of high price of endonuclease, difficult to popularize and use, affecting cost and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] 1 Materials and methods
[0075] 1.1 Main reagents and instruments
[0076] Reagents: 2×PCR mix (MBI Company), restriction endonuclease BsmAI (NEB Company), agarose (BBI Company), primers synthesized by Shanghai Sangon Company.
[0077] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (Pharmacia Biotech, EPS1000), Gel Doc 2000 gel imager (Bio-RAD Company).
[0078] PCR product sequencing was completed by Shanghai Sangon Bioengineering Co., Ltd.
[0079] 1.2 Sequence search and primer design
[0080] Search the PON2 gene sequence and SNP information on the NCBI website, determine the base variation information of the PON2 polymorphic site in combination with relevant literature, and design primers, as follows:
[0081] Forward primer 5' AGGTCCCGTAGTTATGTCTTGT 3' (SEQ ID NO: 1),
[0082] Reverse primer 5'TCAGATGCAACAGAGAATT G TCT 3' (SEQ ID NO: 2);
[0083] 1.3 Extract DNA from whole blood samples as DNA to be tested
[0084] Collect 3...
Embodiment 2
[0102] Example 2 Determination of human PON2 gene rs12026 polymorphism in peripheral blood whole blood samples:
[0103] The steps in Example 1 are basically the same, the forward primer used in the PCR reaction is SEQ ID NO: 7, the reverse primer is SEQ ID NO: 8, the annealing temperature is 57 ° C, and the restriction endonuclease used is Alw26I (MBI);
[0104] Forward primer: 5'TGCCCAGAGGTCCCGTAG 3' (SEQ ID NO: 7)
[0105] Reverse primer: 5′TTCAGATGCAACAGAGAATT G TCT 3' (SEQ ID NO: 8)
[0106] result:
[0107] The amplified sequence (its position corresponds to bases 168-325 in the partial gene sequence containing PON2 polymorphism rs12026, a total of 158bp), the obtained amplification product sequence is as follows (SEQ ID NO: 9):
[0108] tgcccagagg tcccgtag tt atgtcttgta aattaactct gttctttcaa ttctttagat 60
[0109] gacacagttt atctctttgt tgtaaaccac ccagaattca agaatacagt ggaaattttt 120
[0110] aaatttgaag aags agacaa ttctctgttg catctgaa ...
Embodiment 3
[0120] Example 3 Determination of peripheral blood clot specimen Determination of human PON2 gene rs12026 polymorphism:
[0121] The steps are basically the same as in Example 1, except that the following method is used to extract DNA from the peripheral blood clot specimen as the DNA to be tested. In addition, the forward primer used in the PCR reaction is SEQ NO: 12, the reverse primer is SEQ NO: 13, and the annealing temperature is 56°C.
[0122] Forward primer: 5'GTCCCGTAGTTATGTCTTGTAAA 3' (SEQ NO: 12)
[0123] Reverse primer: 5′CAGATGCAACAGAGAATTG TCT 3' (SEQ NO: 13)
[0124] DNA extraction:
[0125] Collect 400 μl of human peripheral blood in a common blood collection tube, and use the RelaxGene Blood DNA System blood genomic DNA extraction system from TIANGEN Company to extract the genomic DNA in the peripheral blood clot as the human genomic DNA template to be tested;
[0126] After the serum in the blood collection tube is separated out, separate the serum, and the...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com