Application of gmndr1 protein in promoting salicylic acid biosynthesis and enhancing plant disease resistance
A salicylic acid and protein technology, applied in the field of protein to enhance plant disease resistance, can solve the problems of high equipment and personnel requirements, low success rate and long cycle.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0068] The present invention will be described in further detail below in combination with specific embodiments.
[0069] The methods used in the following examples are conventional methods unless otherwise specified. The specific steps can be found in: "Molecular Cloning: A Laboratory Manual" (Sambrook J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor). The primer synthesis and DNA sequence determination used were all carried out by Beijing Yingjun Biological Co., Ltd.
Embodiment 1
[0070] Example 1. Acquisition of the GmNDR1 gene related to salicylic acid synthesis
[0071] The Phytozome database and literature were searched to obtain the sequence of the GmNDR1 gene (accession number: Glyma12g34210), and the forward primer was designed: 5'>GCTCTAGAATGGCGGCGGAGCACGAC>3' and the reverse primer 5'>GCGAGCTCGAACCCACAAGCCACAAAAAGG>3'. Extract the RNA of soybean leaves, obtain cDNA by reverse transcription, amplify the gene with TaKaRa’s PrimeSTARHS high-fidelity enzyme method, construct it into the 326-FLAG expression vector, and transform the ligated product into E. coli DH5α by heat shock method For bacterial strains, positive colonies were selected and added to 2.5 ml of LB liquid medium containing 50 mg / L ampicillin, and cultured in a shaker at 37° C. and 180 rpm for 12-16 hours. A small amount of plasmid was extracted, and after enzyme digestion and identification were correct, it was sent to Yingjun Biotechnology Co., Ltd. for sequence determination. ...
Embodiment 2
[0073] Embodiment 2, Arabidopsis salicylic acid synthetic key gene ICS1 gene promoter (Pro AtICS1 ) of the acquisition
[0074]Search the NCBI database and literature, obtain the sequence of AtICS1 (accession number: AT1G74710), analyze the promoter sequence according to the method of bioinformatics, and design forward primers according to the sequence analysis results: 5'>AACTGCAGTTATCCACGCTTTGTCACACA>3' and reverse Primer 5'>CGGGATCCCCATTGCAGAAATTCGTAAAGT>3'. Extract RNA from Arabidopsis leaves, obtain cDNA by reverse transcription, amplify the gene with TaKaRa’s PrimeSTARHS high-fidelity enzyme method, construct it into a 326-GFP expression vector, and transform the ligated product into the large intestine by heat shock method For the Bacillus DH5α strain, select positive colonies and add them to 2.5ml of LB liquid medium containing 100mg / L ampicillin, and cultivate them in a shaker at 37°C and 180rpm for 12-16 hours. A small amount of plasmid was extracted, and aft...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 