Supercharge Your Innovation With Domain-Expert AI Agents!

Pig 4-1BB receptor, gene for encoding pig 4-1BB receptor and application thereof

A receptor gene and gene technology, applied in the field of porcine 4-1BB receptor, can solve the problem that the function of the coding sequence protein has not been reported.

Active Publication Date: 2012-07-11
CHINA AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Furthermore, only the predicted gene sequence information of the pig 4-1BB receptor has been published, and its exact coding sequence and protein function have not been reported before.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig 4-1BB receptor, gene for encoding pig 4-1BB receptor and application thereof
  • Pig 4-1BB receptor, gene for encoding pig 4-1BB receptor and application thereof
  • Pig 4-1BB receptor, gene for encoding pig 4-1BB receptor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 14-1B

[0025] Cloning of embodiment 14-1BB gene

[0026] The invention is based on the relatively high similarity of human and pig gene sequence comparison results, and designs primers according to human 4-1BB sequence, and uses Wuzhishan pig cDNA as a template to obtain the pig 4-1BB suspected sequence. The specific operation steps are:

[0027] (1) By comparing with the human 4-1BB gene sequence, find a gene segment with high similarity in the pig genome, and design primers accordingly (see Table 1: P1 and P2).

[0028] (2) Extraction of porcine peripheral blood mononuclear cells (PBMC) cDNA:

[0029] Aseptically take 20ml of heparin sodium anticoagulant blood from the anterior vena cava of a pig, dilute and mix it with equal volume of PBS, and slowly add it to an equal volume of porcine lymphocyte separation medium (Tianjin Haoxiang, China), with a horizontal rotor Centrifuge at 1800rpm for 20min. Afterwards, the lymphocyte layer under the plasma was aspirated to obtain PBMC. ...

Embodiment 2

[0039] Example 2 Effect of Upregulated Expression of Pig 4-1BB Gene on Pig T Cell Immune Response

[0040] Using the strategy provided by the present invention, the plasmid containing the porcine 4-1BB gene is transfected into porcine peripheral blood mononuclear cells (PBMC, mainly comprising T lymphocytes), and the activation of cells when it is stimulated by antigen (PRRSV) is detected at the cellular level and cytokine secretion activity.

[0041] (1) Construction of eukaryotic expression vector pMax-4-1BBHA. Design upstream primer: 5′(Kpn 1) GGTACCATGGGAAATGGCTACTACAA 3' and downstream primers: 5' (Sac1) CGAGCTCTCA TAG TTCACACTCGCCTTCCT 3' (the frame part is the HA tag sequence), using the cloning vector pEASY-4-1BB-2 containing the 4-1BB gene as a template, amplified the open reading frame fragment of porcine 4-1BB variant 2.

[0042] The reaction system and procedure are the same as Step 3 in Example 1. Both ends of the cloned fragment contain Kpn1 and Sac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pig 4-1BB receptor molecule, which is the flowing protein (1) or (2): the protein (1) is composed of amino acid sequences shown in SEQ ID NO. 3 or 4, and the protein (2) is derived from the protein (1) by substitution, deletion or insertion of one or more amino acids in the amino acid sequences shown in SEQ ID NO. 3 or 4, and has the same activity. . The invention also provides a gene for encoding the pig 4-1BB receptor, which has nucleotide sequences shown in SEQ ID NO. 1 or 2. The costimulatory receptor 4-1BB provided by the invention is specifically and highly expressed in peripheral blood T cells of pig, can enhance activation, proliferation and secretion activity of cell factor when transgenic T cells are suffered from antigenic stimulation, thus enhance acquired immunity response of host and immunity effect of vaccine.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering, and in particular relates to a pig 4-1BB receptor, a gene encoding it and an application thereof. Background technique [0002] China is a large pork production and consumption country. However, the severe epidemics of swine fever, reproductive and respiratory syndrome (PRRSV) and other diseases are the biggest difficulties faced by my country's pig industry. major issues that need to be addressed urgently. However, in recent years, pig diseases have generally presented multi-pathogen cross-infection, and the disease resistance of pigs and the control effect of vaccines have been significantly reduced. Therefore, to do a good job in epidemic prevention and control, it is necessary to find new strategies for vaccine development, or seek alternative or auxiliary approaches, such as breeding new breeds of pigs with disease resistance. However, most of the existing research results are devo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/715C12N15/12C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A61K39/395A61P31/00A01K67/027
Inventor 索勋刘贤勇苏华荔赵新新黄骁舾
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More