Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Proteases with modified pre-pro regions

A technology of protease and serine protease, applied in hydrolytic enzymes, organic chemistry, biochemical equipment and methods, etc.

Inactive Publication Date: 2012-07-11
DANISCO US INC
View PDF9 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although various approaches have been employed to increase protease production, including screening for high-producing strains, cloning and overexpressing proteases, improving fed-batch and chemostat fermentations, and optimizing fermentation techniques, additional means are still needed to increase protease production. protease production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Proteases with modified pre-pro regions
  • Proteases with modified pre-pro regions
  • Proteases with modified pre-pro regions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0132] Construction of Targeted ISD (Insertion Substitution Deletion) Library

[0133] The method (ISD method) used to construct a library of modified FNA polynucleotides is shown in FIG. 2 . Using two sets of oligonucleotides that evenly cover the sequence of the FNA gene encoding the prepro region (SEQ ID NO: 7) of the full-length protein (SEQ ID NO: 1) of 392 amino acids in forward and reverse directions, the encoding Left and right fragments of the FNA gene portion of the prepro region of FNA. Both PCR reactions (left and right fragments) contained 5'forward or 3'reverse gene sequence flanking oligonucleotides, each oligonucleotide combined with the corresponding opposing primer oligonucleotide. The fragment on the left was amplified using a single forward primer (P3233, TTATTGTCTCATGAGCGGATAC; SEQ ID NO: 123) containing an EcoRI site and reverse primers P3301r-P3404r (SEQ ID NOS: 124-227; Table 1) each containing an Eam104I site . A single reverse primer containing a M...

Embodiment 2

[0170] Generation of mutated prepro polypeptides comprising combinations of mutations by ISD

[0171] To determine the effect of combining at least 2 mutations in the prepro FNA sequence, the combinations of mutations listed in Table 3 were generated as follows.

[0172] Using the pAC-FNA10 plasmid DNA containing the mutations in Table 3 as a template, extension PCR was performed to add another mutation also selected from the mutations described in Table 3. Two PCR reactions (left and right fragments) contained 5'forward or 3'reverse gene sequence flanking oligonucleotides, each combined with a corresponding opposing primer oligonucleotide. A single forward primer (P3234, ACCCAACTGATCTTCAGCATC; SEQ ID NO: 411 ) and a reverse primer for the specific mutations shown in Table 4 were used to amplify the fragment on the left. The right fragment was amplified using a single reverse primer (P3242, ACCGTCAGCACCGAGAACTT; SEQ ID NO: 412) and a forward primer for the specific mutations ...

Embodiment 3

[0193] Site evaluation libraries (SELs) were constructed to generate position libraries at each position comprising the first 103 amino acid positions of the FNA prepro region. Site saturation mutagenesis of the prepro sequence of the full-length FNA protease was performed to identify amino acid substitutions that increase FNA production by bacterial host cells.

[0194] SEL library construction

[0195] Prepro-FNA SELs were generated using DNA 2.0 (Menlo Park, CA) using technology platforms for gene optimization, gene synthesis, and library construction under proprietary DNA 2.0 know-how and / or intellectual property. 将包含全长FNA多核苷酸(GTGAGAAGCAAAAAATTGTGGATCAGTTTGCTGTTTGCTTTAGCGTTAATCTTTACGATGGCGTTCGGCAGCACATCCAGCGCGCAGGCGGCAGGGAAATCAAACGGGGAAAAGAAATATATTGTCGGGTTTAAACAGACAATGAGCACGATGAGCGCCGCTAAGAAGAAAGATGTCATTTCTGAAAAAGGCGGGAAAGTGCAAAAGCAATTCAAATATGTAGACGCAGCTTCAGCTACATTAAACGAAAAAGCTGTAAAAGAATTGAAAAAAGACCCGAGCGTCGCTTACGTTGAAGAAGATCACGTAGCACACGCGTACGCGCAGTCCGTGCCTTACGGCGTATCACAAAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to modified polynucleotides encoding modified proteases, and methods for altering the production of proteases in microorganisms. In particular, the modified polynucleotides comprise one or more mutations that encode modified proteases having modifications of the pre-pro region that enhance the production of the active enzyme. The present invention further relates to methods for altering the production of proteases in microorganisms, such as Bacillus species.

Description

technical field [0001] The present invention relates to modified polynucleotides encoding modified proteases, and the present invention also relates to methods for altering the production of proteases in microorganisms. In particular, the modified polynucleotide comprises one or more mutations encoding a modified protease having an altered pre-pro region that enhances the production of the active enzyme. The invention also relates to methods for altering the production of proteases in microorganisms such as Bacillus species. Background technique [0002] Proteases of bacterial origin are important industrial enzymes, accounting for the majority of all enzyme sales, in a variety of industries including detergents, meat tenderization, cheese making, dehairing, baking, brewing, production of digestive aids, and from Photographic film recycling silver) is widely used. The use of these enzymes as detergent additives facilitated their commercial development and led to a substant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/54C12N15/57C07H21/04
CPCC12N9/54
Inventor A·比萨奇科B·F·施密特
Owner DANISCO US INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com