LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum
A technology of Mycoplasma gallisepticum and a test kit, applied in the biological field, can solve the problems of long time consumption, low sensitivity, inability to determine the infection content of Mycoplasma gallisepticum and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] Embodiment 1, the design of primer and the preparation thereof kit
[0072] 1. Design of primers
[0073] According to the general gene conservation region (genbank: 335501-335700 nucleotides of CP001872.1) of strong and weak strains of Mycoplasma gallisepticum (MG) and the weak virus-specific gene conservation region (genbank: 603238- 603785 nucleotides), the following primers were designed:
[0074] The sequence of strong and weak toxic universal internal primer 1 is:
[0075] CCTTGTTACGACTTAACTCCAAATCAGTTGCTAACCGCAAGGAA (sequence 1),
[0076] The strong and weak toxic universal internal primer 2 sequence is:
[0077] AACGTGGGGGTGGATTACCTACCGTTATATGTAACAGGTGTA (sequence 2),
[0078] The sequence of strong and weak toxic universal outer primer 1 is: AGCTGGTAATATCTAAAAACCGT (sequence 3),
[0079] The sequence of strong and weak toxic universal outer primer 2 is: CTTGCTGGGTTTTAATTGTTTC (sequence 4),
[0080] The sequence of strong and weak toxic universal loop prim...
Embodiment 2
[0093] Example 2, the application of primers and kits thereof in the detection of strong and weak strains of Mycoplasma gallisepticum by LAMP
[0094] 4 virulent strains of MG (S6, A5969, K-2221(383T), K-1501-S) and 2 attenuated strains of MG (F2F10, K810) are described in the following reference 1; another virulent strain of MG Strain PG31 is described in reference 2 below;
[0095] MG attenuated vaccine strain (MG-F-vaccine) and chicken infectious laryngotracheitis virus (ILTV) were provided by China Veterinary Drug Administration; MG attenuated vaccine (MG-F-vaccine-Guangdong) was provided by Guangdong Yongshun Bioengineering Co., Ltd. ;
[0096]Records of Mycoplasma gallisynovii (MS-K1415), Mycoplasma turkey (MM-TACC), Mycoplasma Iowa (MI-I695), Newcastle disease virus (NDV-Lasota) and chicken infectious bronchitis virus (IBV Mass 41) In reference 3 below;
[0097] Avian influenza virus (AIV H9) is described in Reference 4 below.
[0098] References: [1] Han Wang, A.A....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap