Visual detection method for PCR (polymerase chain reaction) amplification and endpoint

A chain reaction and detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as cross-contamination, endanger the health of operators, and restrict promotion and application, achieve the image of test results, and avoid false positives. Positive questions, the effect of simplifying the testing process

Inactive Publication Date: 2019-05-03
TIANDZ INC
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The electrophoresis method requires the use of highly carcinogenic fluorescent dyes such as ethidium bromide, which not only endangers the health of operators, but also may cause cross-contamination when opening the cover; the fluorescent dye method is mainly based on the detection of amplified product DNA, which requires expensive fluorescent quantification PCR instruments limit the popularization and application of this technology in basic testing departments and medical departments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Visual detection method for PCR (polymerase chain reaction) amplification and endpoint
  • Visual detection method for PCR (polymerase chain reaction) amplification and endpoint

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Design of primers for the amplification detection of human pathogenic Mycobacterium tuberculosis specific gene IS6110 The 812-1045 nucleic acid sequence of human pathogenic Mycobacterium tuberculosis IS6110 was screened by reviewing the literature and analyzing with BLAST software, and the two fragments Site (the two sites: 812–831bp and 1029–1045bp respectively) designed and synthesized PCR primers to obtain the following primers; the primer design was completed by PCR-specific primer design software. Forward primer F-MYC-IS6110AGACCTCACCTATGTGTCGA Reverse primer R-MYC-IS6110TCGCTGAACCGGATCGA. Reaction system (total reaction volume is 30μL): 100ng nucleic acid template, 10uM F-MYC-IS6110, 10μM R-MYC-IS6110, 0.2μM dNTP, 0.2mM visible light dye, 1X PCR Buffer, 5U Taq DNA Polymerase, supplemented with ddH 2 0 to 30 μL.

[0026] Amplification reaction program: 95°C for half a minute, 50°C for half a minute, 72°C for half a minute, 30 cycles. The results judge that after ...

Embodiment 2

[0028] Design of primers for the amplification detection of Shigella specific gene ipaH in food The 232-437 nucleic acid sequence of Shigella specific gene ipaH was screened out by consulting the literature and using BLAST software analysis, targeting two sites of this fragment (These two sites are located at 233-254bp and 420-438bp respectively) PCR primers were designed and synthesized to obtain the following primers; the primer design was completed by PCR-specific primer design software. Forward primer F-ipaHCATGGCTGGAAAAACTCAGTGC Reverse primer R-ipaHGAGGCGGAACATTTCCCTG. Reaction system (total reaction volume is 30μL): 100ng nucleic acid template, 10uMF-ipaH, 10μM R-ipaH, 0.2μM dNTP, 0.1-0.3mM visible light dye, 1X PCR Buffer, 5U Taq DNAPolymerase, supplemented with ddH 2 0 to 30 μL.

[0029] Amplification reaction program: 95°C for half a minute, 52°C for half a minute, 72°C for half a minute, 35 cycles. The results judge that after the reaction is over, the reaction sy...

Embodiment 3

[0031] Amplification and detection primer design of Macrobrachium rosenbergii nodavirus RNA-2 Through literature review and BLAST software analysis, the specific gene fragment RNA-2 of Macrobrachium rosenbergii Nodavirus was screened out, targeting two sites of the fragment (these two The two sites are respectively: 1976-1994bp and 2198-2216bp) PCR primers were designed and synthesized to obtain the following primers; the primer design was completed by PCR-specific primer design software. Forward primer F-RNA-2CCAATATGAACCGGGAGTG Reverse primer R-RNA-2GGGTTCAACCTTGAGTTCC. Reaction system (total reaction volume is 30μL): 100ng nucleic acid template, 10uM F-RNA-2, 10μM R-RNA-2, 0.2μM dNTP, 0.1-0.3mM visible light dye, 1X PCR Buffer, 5U Taq DNAPolymerase, supplemented with ddH 2 0 to 30 μL.

[0032] Amplification reaction process: 95°C for half a minute, 53°C for half a minute, 72°C for half a minute, 40 cycles. The results judge that after the reaction is over, the reaction sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a visual detection method for PCR (polymerase chain reaction) amplification and an endpoint. The method comprises the steps as follows: adding a visible light dye with aconcentration of 0.1-0.3 mM into an amplification system before the PCR amplification reaction, and judging the reaction result by observing the color change of a complex formed by the visible lightdye and substances in the reaction system. The detection phase visually determines the detection result. The method is simple and easy, avoids cross-contamination caused by the cover opening, avoids harm to the human body, and reduces the detection cost.

Description

technical field [0001] The invention relates to the technical field of nucleic acid amplification and detection, in particular to a PCR (polymerase chain reaction) amplification and visual detection method for an end point. Background technique [0002] With the development of modern molecular biology and molecular technology, many nucleic acid amplification techniques have been researched and developed. Among them, PCR (polymerase chain reaction, polymerase chain reaction) technology occupies an important position in the field of nucleic acid specific amplification and detection due to its strong specificity, high sensitivity, and fast reaction speed, and has become a research center in the field of life sciences. One of the hot spots. The main principle of PCR amplification is based on the design of two specific primers for the target sequence, using a heat-resistant DNA polymerase (Taq DNA polymerase), and cycling 30-40 times at three temperatures or two temperatures to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6848
Inventor徐堤
OwnerTIANDZ INC