Check patentability & draft patents in minutes with Patsnap Eureka AI!

LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof

A technology of transgenic corn and detection kit, which is applied in the field of molecular biology to achieve the effects of simple identification, strong strain specificity and high sensitivity

Active Publication Date: 2013-07-17
广州迪澳生物科技有限公司 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Loop-Mediated Isothermal Amplification (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene developed by Eiken Chemical Co., Ltd. in Japan around 2000 Amplification technology, which has the advantages of fast, simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies the LAMP method to the rapid detection of transgenic corn MIR604 and its derivatives.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof
  • LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Kit containing chromogen and detection method thereof:

[0056] LAMP detection kit for transgenic maize MIR604 and its derivatives, including primer solution, reaction solution, DNA polymerase, control and color reagent:

[0057] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0058] Outer primer 1: ACGACGATCGATCTCCAT (SEQ ID No: 1)

[0059] Outer primer 2: TCTCTTCTCGATAGGCAGATTA (SEQ ID No: 2)

[0060] Internal primer 1: AGGGCGCGTCGAAATGATTGGCCCTTCTCACCAATTC (SEQ ID No: 3)

[0061] Inner primer 2: GCCCTTATCTCCTTCCCGTGCTAGCCTGGTTAGCAACG (SEQ ID No: 4)

[0062] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0063] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0064] (4) Control: The positive control is the DNA of transgenic corn MIR604 at a con...

Embodiment 2

[0072] Embodiment 2 The kit and detection method thereof without chromogenic agent:

[0073] The kit is the same as in Example 1 except that the color developing agent in Example 1 is lacking.

[0074] Use the above kit to detect the corn variety to be tested in the following way:

[0075] (1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0076] (2) Constant temperature gene amplification reaction: prepare reaction system in 200ul PCR tube: primer solution 1μl, reaction solution 12.5μl, DNA polymerase 1μl, DNA to be tested 2μl, make up to 25μl with sterilized deionized water; set positive control During the reaction, the DNA to be tested was replaced with the DNA of transgenic corn MIR604 at a concentration of 5% or the E. coli plasmid DNA containing the target gene. When setting a negative control reaction, the DNA to be tested was replaced with a reaction mixture without the target gene; the p...

Embodiment 3

[0080] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention:

[0081] Prepare the LAMP detection kit for transgenic maize MIR604 and its derivatives according to the following formula:

[0082] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0083] Outer primer 1: ACGACGATCGATCTCCAT (SEQ ID No: 1)

[0084] Outer primer 2: TCTCTTCTCGATAGGCAGATTA (SEQ ID No: 2)

[0085] Internal primer 1: AGGGCGCGTCGAAATGATTGGCCCTTCTCACCAATTC (SEQ ID No: 3)

[0086] Inner primer 2: GCCCTTATCTCCTTCCCGTGCTAGCCTGGTTAGCAACG (SEQ ID No: 4)

[0087] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0088] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0089] (4) Control: The positive control is the DNA of transgenic corn MIR604 at a concent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof. The detection primer group comprises four specific primers. The detection kit comprises a primer solution, a reaction solution, DNA (deoxyribonucleic acid) polymerase, controls and a color developing agent. The detection method is characterized by comprising the following steps: extracting the DNA of the maize variety to be detected, adopting the four specific primers and the DNA polymerase with strand displacement activity to amplify the sample DNA template at 63-65 DEG C, adding SYBRGreenI to observe color change or observing change of turbidity of the precipitates in a reaction tube with a turbidity meter to judge whether the sample DNA template is amplified and determining whether the maize variety to be detected contains or is the transgenic maize MIR604 and derived varieties thereof, wherein the short-time amplification efficiency can reach 109-1010 copies. The detection primer group, kit and method disclosed by the invention have the advantages of quickness, efficiency, simpleness and convenience in operation and identification, high specificity, high sensitivity, suitability for field detection and the like and are suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection kit and a detection method for transgenic plant varieties, in particular to a LAMP detection kit and a detection method for transgenic corn MIR604 and derivatives thereof. Background technique [0002] According to the report "2010 Global Biotech / GM Crops Commercialization Development Status" recently published by the International Agricultural Biotechnology Application Service, about 100 million farmers have made planting decisions in the past 15 years due to the huge benefits brought by genetically modified crops . In the 15 years since GM crops were commercially planted, the cumulative area of ​​GM crops in the world has exceeded 1 billion hectares. In 2010, 15.4 million farmers in 29 countries around the world planted a total of 148 million hectares of biotech crops. From 1996 to 2010, the global hectarage of biotech crops increased 87-fold. For the fir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 刘津凌莉李志勇庄阳阳肖艳文石磊
Owner 广州迪澳生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More