High expression and production method of recombinant human thrombin in animal cell

A technology of human thrombin and thrombin, applied in the biological field, can solve the problems of rising production costs and low expression efficiency

Active Publication Date: 2012-09-26
SUZHOU ZELGEN BIOPHARML
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, when CHO cells are used for expression, the expression efficiency is low, leading to unfavorable factors such as increased production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High expression and production method of recombinant human thrombin in animal cell
  • High expression and production method of recombinant human thrombin in animal cell
  • High expression and production method of recombinant human thrombin in animal cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1: Preparation of human prothrombin-2 gene

[0071] step one,

[0072] Using the extracted human hepatocyte mRNA as a template and Oligo-dT as a primer, the first-strand cDNA was synthesized by reverse transcription. Using cDNA as template, PCR reaction was carried out with high-fidelity DNA polymerase. Its primer sequence is as follows:

[0073] Primer 1: tgctgcggatccgcaaacgtcgtaccgccaccagtgagta (SEQ ID NO: 11);

[0074] Primer 2: atatgcggccgcctactctccaaactgatcaatga; (SEQ ID NO: 12)

[0075] Primer 3: tgctccagcgggtccggcgaaccgccaccagtgagtacca (SEQ ID NO: 13)

[0076] Primer 1 contains the C-terminal sequence of human protein C signal peptide and the N-terminal coding sequence of human prothrombin-2. Primer 2 contains the C-terminal coding sequence of human prothrombin-2 and introduces a NotⅠ restriction site. The chimeric gene of the peptide partial sequence and the complete coding region of human prothrombin-2, its sequence is as SEQ ID NO:1

[0077] P...

Embodiment 2

[0089] Example 2: Construction of Human Prothrombin-2 Expression Plasmid

[0090] The amplified product and the pGN vector (see Chinese patent 200910052576.1) were double-digested with KpnI and NotI respectively, and after the digested product was purified, the amplified product: pGN vector (molar ratio 3:1) was ligated with T4 DNA ligase to form ring. Construct the expression plasmids pGN / pc-PT2 and pGN / th-PT2, see the plasmid map image 3 .

Embodiment 3

[0091] Example 3: Using animal cells to express human prothrombin-2

[0092] The expression plasmid described in Example 2 was used to transfect conventional DHFR-deficient Chinese hamster ovary cells CHO DG44 (G Urlaub et al., somatic cells, Mol. Genet., 12, p555-556, 1986, hereinafter referred to as CHO).

[0093] The cells were cultured normally by adding hypoxanthine and thymine (HT) in commercial serum-free Excell-302 medium (Sigma Company), and the transfection was performed by electroporation. The process was as follows: CHO cells in logarithmic growth phase 24 hours before transfection, centrifuge to change the medium, resuspend with fresh medium and pipette into a single cell suspension; centrifuge the cells and follow the 10 7 Resuspend the cells at the density per milliliter, take 0.8 mL and put it into a 0.4 cm electric shock cup; add 200 micrograms of expression plasmid pGN / pc-PT2 or pGN / th-PT2, mix gently to avoid air bubbles; ice bath for 10 Minutes; electrot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high expression and production method of recombinant human thrombin in animal cells. Specifically, the invention provides a fusion gene and a fusion protein coded by the same. The gene contains signal peptide sequence of human protein C and Gla structural domain deleted human prothrombin gene sequence, and can enhance expression level of human prothrombin-2. The invention also discloses a method for employing a recombinant expression vector containing the above nucleotide sequence to express and produce human prothrombin in animal cells. The invention also discloses a method for producing recombinant human thrombin by purification and activation. The recombinant human thrombin produced by the invention has biological activity satisfying treatment of correlative clinic diseases.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, it relates to a high-efficiency expression and production method of recombinant human thrombin in animal cells. Background technique [0002] Thrombin is a key enzyme in the body's blood coagulation system. It is produced in the damaged vascular endothelial cells and participates in various reaction steps of the blood coagulation process. Thrombin is a highly specific serine proteolytic enzyme that is activated by prothrombin. It consists of 308 amino acid residues and has a molecular mass of 36KD. Thrombin is a double-chain molecule containing an A chain and a B chain connected by a disulfide bond. The A-chain contains 49 amino acid residues, also known as the light chain; the B chain consists of 259 amino acid residues, also known as the heavy chain (Raimondo De Cristofaro et al. A natural prothrombin mutant reveals an unexpected influence of the A-chain's structure on the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/74C12N15/62C12N15/63C12N5/10
Inventor张滨徐志刚盛泽林
OwnerSUZHOU ZELGEN BIOPHARML