Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof

A technology of Mycobacterium tuberculosis and multi-drug resistance, applied in the field of medicine and biology, can solve the problems of ineffective high-throughput detection, unfavorable combination of PCR products and probes, and ineffective high-throughput detection. The effect of short time, strong sensitivity and high accuracy

Active Publication Date: 2012-10-10
CHANGCHUN BCHT BIOTECH +1
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the detection environment is a solid phase, it is not conducive to the combination of PCR products and probes, and the detection carrier is a glass slide, which is much larger than the micron level. When the number of samples is large, high-throughput detection cannot be effectively performed.
In addition, although the detection time of this method is short, it has high requirements for instruments and technicians, poor repeatability, and cannot effectively perform high-throughput detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof
  • Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof
  • Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1 detects the liquid phase chip of multidrug-resistant Mycobacterium tuberculosis, including

[0057] 1. Specific primers with tag sequences

[0058] Specific primer sequences were designed for katG531, rpoB526, rpoB531, and inhA-15 associated with multidrug-resistant Mycobacterium tuberculosis. The specific primer with tag sequence consists of "tag sequence + specific primer sequence". The specific primer sequences with tag sequences are shown in the table below:

[0059] Table 1 Specific primer sequence with tag sequence (tag sequence + specific primer sequence)

[0060]

[0061] The numbers in brackets represent SEQ ID NO.; wt represents wild type; m represents mutant type; m1 represents mutant type I; m2 represents mutant type II.

[0062] Each specific primer with a tag sequence includes two parts, the 5' end is a specific tag sequence for the complementary sequence of the tag on the relative microsphere, and the 3' end is a mutant or wild-type spe...

Embodiment 3

[0144] Embodiment 3: Simultaneous detection of said 4 sites and the comparison of detecting said 4 sites respectively

[0145] As in the above experimental procedure, 10 drug-resistant samples were tested for 4 sites, and compared with the results of simultaneous detection of the 4 sites in a reaction system in Example 2. The test results are compared in Table 8 below. The results in Table 8 show that there is no significant difference in the experimental results whether the four sites are detected in a single reaction or in a reaction system.

[0146] Table 8: The results of simultaneous detection of 4 loci in 10 drug-resistant samples (sample numbers 1-10) and the results of detection of 4 loci separately (sample numbers 1A-10A).

[0147]

Embodiment 4

[0148] Example 4: Comparison of the results of simultaneous detection of 5 sites and simultaneous detection of 4 sites

[0149] In order to verify the impact of adding sites on the sensitivity of detection and whether adding sites is necessary, add sites inhA-8, wild-type T, and mutant G. For samples 1-20, the results of simultaneous detection of 5 sites and simultaneous detection of 4 sites were compared.

[0150] The experimental procedure is as above, but adding inhA-8 wild-type (inhA-8-wt) microsphere code No.42; inhA-8 mutant (inhA-8-m) microsphere code No.63. inhA-8-wt primers: tag sequence: CACTACACATTTATCATAACAAAT; specific primer sequence: TGGCAGTCACCCCGACAA. inhA-8-m primer: tag sequence: CTAAATCACATACTTAACAACAAA; specific primer sequence: TGGCAGTCACCCCGACAC. The results are shown in Table 9 below. From the comparison of the two sets of data in Table 9, it can be seen that when a new detection site is added, it will interfere with the detection of other sites, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a method and a chip for detecting multidrug-resistant mycobacterium tuberculosis. The method and the chip disclosed by the invention relate to detection of katG315 mutant I and / or II or rpoB526 mutant I and / or II, rpoB531 mutant I and / or II, and inhA-15 mutant. The invention also provides a primer for detecting the mutants.

Description

technical field [0001] The invention relates to the field of medical biology, in particular to the detection of multidrug-resistant mycobacterium tuberculosis. Background technique [0002] Multidrug-resistant tuberculosis has high morbidity and mortality worldwide, especially in Asia, especially China and India. Currently, rifampicin (RIF) and isoniazid (INH) are the drugs of choice for the treatment of tuberculosis. Clinically, as long as there is resistance to the two drugs at the same time, it is diagnosed as multidrug-resistant tuberculosis (MDR, Multi-drug-resistant tuberculosis). tuberculosis). MDR-TB is so difficult to treat that it is almost incurable. Therefore, the medical community equates severe MDR-TB with cancer. [0003] The combined mycobacteria that cause MDR-D are called MDR-TB. At present, traditional drug susceptibility testing is widely used to detect multidrug-resistant Mycobacterium tuberculosis, which is based on phenotypic drug resistance, inocu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/32
Inventor姜春来孔维韩明明
OwnerCHANGCHUN BCHT BIOTECH