Gene construction method for improving resistance of potatoes to leaf roll virus
A leaf-rolling virus, construction method technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., to achieve the effect of avoiding biological risks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment
[0022] Step 1: Acquisition of Potato Leafroll Virus Multigene Fusion Sequence CCGACACGATCGTGAGCTCG
[0023] 1. According to the genome sequence of PLRV (Accession: NC-001747), design PCR primers:
[0024] Forward primer 1: 5'-GCATCGATTCCGACACGATCGTGAGCTCGT-3', artificially added a ClaI restriction site at the 5' end;
[0025] Reverse primer 1: 5'-CGTGGTTACCTGAACTGTTAGCGCGCCT-3', artificially added a BstEII restriction site at its 5' end;
[0026] Forward primer 2: 5'-CTGGTACCGACACGATCGTGAGCTCGT-3', artificially added a KpnI restriction site at its 5' end;
[0027] Reverse primer 2: 5'-TCAGATCTGAACTCTGTTAGCGCGCCT-3', artificially added BglII restriction site at its 5' end.
[0028] Primers were synthesized by Beijing Sanbo Polygala Biotechnology Co., Ltd.
[0029]2. Synthesis of the first strand of cDNA: Extract RNA from potato tubers infected with PLRV virus, take 2 μL, then add 10 μM reverse primer 1 2 μL, 10 mM dNTP 2 μL, ddH2O 12 μL, 65 ° C water bath for 5 min, ice bath...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com