Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene construction method for improving resistance of potatoes to leaf roll virus

A leaf-rolling virus, construction method technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., to achieve the effect of avoiding biological risks

Inactive Publication Date: 2012-11-21
CROP SCI RES INST SHANXI ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of RNA interference to silence multiple genes of the PLRV virus has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene construction method for improving resistance of potatoes to leaf roll virus
  • Gene construction method for improving resistance of potatoes to leaf roll virus
  • Gene construction method for improving resistance of potatoes to leaf roll virus

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0022] Step 1: Acquisition of Potato Leafroll Virus Multigene Fusion Sequence CCGACACGATCGTGAGCTCG

[0023] 1. According to the genome sequence of PLRV (Accession: NC-001747), design PCR primers:

[0024] Forward primer 1: 5'-GCATCGATTCCGACACGATCGTGAGCTCGT-3', artificially added a ClaI restriction site at the 5' end;

[0025] Reverse primer 1: 5'-CGTGGTTACCTGAACTGTTAGCGCGCCT-3', artificially added a BstEII restriction site at its 5' end;

[0026] Forward primer 2: 5'-CTGGTACCGACACGATCGTGAGCTCGT-3', artificially added a KpnI restriction site at its 5' end;

[0027] Reverse primer 2: 5'-TCAGATCTGAACTCTGTTAGCGCGCCT-3', artificially added BglII restriction site at its 5' end.

[0028] Primers were synthesized by Beijing Sanbo Polygala Biotechnology Co., Ltd.

[0029]2. Synthesis of the first strand of cDNA: Extract RNA from potato tubers infected with PLRV virus, take 2 μL, then add 10 μM reverse primer 1 2 μL, 10 mM dNTP 2 μL, ddH2O 12 μL, 65 ° C water bath for 5 min, ice bath...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene construction method for improving resistance of potatoes to a leaf roll virus, belonging to the field of biological technology. The method comprises the following steps: extracting total DNA from a plant infected by the potato leaf roll virus (PLRV) and carrying out RT-PCR amplification and gene cloning so as to obtain a conserved sequence of the leaf roll virus, wherein the conserved sequence comprises a replicase gene, an intergenic region and a coat protein gene and is located between the 3422nd nucleotide and 3790th nucleotide of the genome of the leaf roll virus; and respectively connecting the conserved sequence in a forward direction and the conserved sequence in a reverse direction to two sides of an intron to construct an inverted repeat sequence, i.e., the gene RNAiNibIsCp, and respectively connecting a promoter and a terminator to two ends of the gene. According to the invention, the potential biological risk that conventional antiviral transgenic means may lead to occurrence of homologous recombination or heterologous packaging a virus and a transgene is avoided; the cloned sequence NibISCp in the plant enables three genes of the PLRV virus to be silent at the same time, which enables resistance to the PLRV virus to be improved.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a gene construction method, in particular to a gene construction method for improving potato resistance to leafroll virus. Background technique [0002] Potato leaf roll virus (PLRV) is one of the most harmful viruses in potato production, and it is distributed in all potato producing areas in the world. PLRV is transmitted by aphids, primarily the green peach aphid (Myzus persicae), in a persistent, cyclical manner. After the potato is infected with PLRV, the normal physiological functions are destroyed, the leaves are curled and yellowed, the leaves are thick and brittle, the branches are rigid, the plants are dwarfed, and the tubers are necrotic, which seriously affects the yield and quality. In order to improve the resistance of potatoes to leaf curl virus, virus-free tissue culture measures are adopted in production to produce seed potatoes with very low virus content, but the cos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/40C12N15/113
Inventor 白云风张维锋闫建俊张忠梁施俊凤郭志华
Owner CROP SCI RES INST SHANXI ACADEMY OF AGRI SCI