Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof

A technology for embryonic stem cells and cell lines, which is applied in the field of obtaining the stem cell lines by homologous gene recombination technology, can solve the problems of the limitation of the length of the homologous arm and the low efficiency of the gene homologous recombination of embryonic stem cells, and achieves the effect of strong practicability.

Inactive Publication Date: 2013-01-23
WUHAN DANMIYOU BIOLOGICAL MEDICAL
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although gene targeting technology was applied to transform embryonic stem cell genes earlier, most of the targeting vectors used to be constructed by restriction enzyme digestion technology, and the length of the homology arms of the targeting vector was limited due to the limitation of the enzyme cutting site, which made Genetic homologous recombination in embryonic stem cells is extremely low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof
  • Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof
  • Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] 1. Targeting carrier construction

[0040] (1) Construction of targeting vector 3 (see figure 1 , 2 、5)

[0041] 1.PCR amplification of rpsl-neo fragments containing homology arms

[0042] 1.1 Primer design

[0043] 1.1.1 Primers for the selection marker gene insert (rpsl-neo cassette) (see image 3 ) The upstream primer design includes a 50bp homology arm at the 5' end and a 24bp primer at the rpsl-neo at the 3' end; the downstream primer design includes a 50bp homology arm at the 5' end and a 22bp primer at the rpsl-neo at the 3' end.

[0044] upstream primer

[0045] AATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTGGCCTGGTGATGATGGCGGGATCG

[0046] downstream primer

[0047] AGCAGATGACCATGACAAGCAGCGGCAGGACCAGCCCAAGATGACTATCCTCGAGTCAGAAGAACTCGTCAAGAAGG

[0048] 1.1.2 CCR5Δ32 oligonucleotide fragment (CCR5Δ32DNA) synthetic primer (see Figure 4 )

[0049] upstream primer

[0050] GGTGGTGGCTGTGTTTGGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant CCR5[delta]32 genotype embryonic stem cell strain, and further relates to a preparation method of the stem cell strain. The method performs site-directed deletion and modification for 32 bases of the CCR5 gene of human embryonic stem cells by using a homologous recombination technology, and builds the immortalized primate embryonic stem cell strain with the CCR5[delta]32 / [delta]32 genotype. The obtained cell strain can not only resist the intrusion of the virus, but also retain other functions of the CCR5 after being orientedly induced and differentiated to CD4 positive cells, thereby providing a new approach for treating AIDS.

Description

Technical field: [0001] The invention relates to a recombinant CCR5Δ32 / Δ32 genotype embryonic stem cell strain, and also relates to a method for obtaining the stem cell strain by using homologous gene recombination technology. Background technique: [0002] CCR5 is one of the combined receptors on the surface of T cells that binds to HIV. Researchers have been looking for ways to change or destroy the function of CCR5 receptors, hoping to achieve the purpose of treating AIDS. Someone used zinc finger nuclease to disrupt the expression of CCR5 gene in hematopoietic stem cells (Nathalia Holt et al. Human hematopoietic stem / progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo. Nat Biotechnology 28(8): 839-47, 2010 .) to mutate the CCR5 gene. However, the disadvantage of this method is that the CCR5 gene of T cells is completely inactivated, and other functions of CCR5 cannot be retained. Moreover, the cells in which the CCR5 gene is inacti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/0735C12N15/09A61K35/48A61P31/18A61K35/545
Inventor 李东升曾毅卢智勇滕智平
Owner WUHAN DANMIYOU BIOLOGICAL MEDICAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com