Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof
A technology for embryonic stem cells and cell lines, which is applied in the field of obtaining the stem cell lines by homologous gene recombination technology, can solve the problems of the limitation of the length of the homologous arm and the low efficiency of the gene homologous recombination of embryonic stem cells, and achieves the effect of strong practicability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] 1. Targeting carrier construction
[0040] (1) Construction of targeting vector 3 (see figure 1 , 2 、5)
[0041] 1.PCR amplification of rpsl-neo fragments containing homology arms
[0042] 1.1 Primer design
[0043] 1.1.1 Primers for the selection marker gene insert (rpsl-neo cassette) (see image 3 ) The upstream primer design includes a 50bp homology arm at the 5' end and a 24bp primer at the rpsl-neo at the 3' end; the downstream primer design includes a 50bp homology arm at the 5' end and a 22bp primer at the rpsl-neo at the 3' end.
[0044] upstream primer
[0045] AATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTGGCCTGGTGATGATGGCGGGATCG
[0046] downstream primer
[0047] AGCAGATGACCATGACAAGCAGCGGCAGGACCAGCCCAAGATGACTATCCTCGAGTCAGAAGAACTCGTCAAGAAGG
[0048] 1.1.2 CCR5Δ32 oligonucleotide fragment (CCR5Δ32DNA) synthetic primer (see Figure 4 )
[0049] upstream primer
[0050] GGTGGTGGCTGTGTTTGGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

![Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof](https://images-eureka.patsnap.com/patent_img/e901284f-f7e6-47b6-920d-ba4200bcabbf/HDA0000076606940000011.png)
![Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof](https://images-eureka.patsnap.com/patent_img/e901284f-f7e6-47b6-920d-ba4200bcabbf/HDA0000076606940000012.png)
![Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof](https://images-eureka.patsnap.com/patent_img/e901284f-f7e6-47b6-920d-ba4200bcabbf/HDA0000076606940000021.png)