Recombinant expression of actinoporins proteins

A cytolysin and sea anemone technology, which is applied in the field of recombinant expression of sea anemone cytolysin protein, can solve the problems of insufficient toxin acquisition, sea anemone marine resources and ecological environment damage.

Inactive Publication Date: 2013-02-13
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] It can be seen that the separation and purification of sea anemone tentacle protein is currently the main method to obtain sea anemone toxin protein, but on the one hand, this method cannot obtain enough toxins for in-depth research, and on the other hand, it is also harmful to the killing of sea anemone. Destruction of marine resources and ecological environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression of actinoporins proteins
  • Recombinant expression of actinoporins proteins
  • Recombinant expression of actinoporins proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Construction of recombinant sea anemone cytolysin expression plasmid

[0050] Synthesize a pair of primers according to the two-terminal sequence of the mature protein encoded by the gigtIV gene and the multi-restriction site of the prokaryotic expression vector pET-22b, the upstream primer contains the Nde I restriction sequence (CATATG), and the downstream primer contains the Xho I restriction sequence (GGATCC ), the sequence is as follows:

[0051] Upstream primer: 5'AAA CATATG AGTGCTTCAGAAGTCGCTG 3' (SEQ ID NO: 3, the underlined part is the Nde I restriction sequence that is not translated)

[0052] Downstream primer: 5'TTT CTCGAG GCGTGAAATCTTAATTTGCAG 3' (SEQ ID NO: 4, the underlined part is the sequence cut by Xho I)

[0053] PCR amplification and gene cloning were carried out according to conventional methods. The PCR product is about 540bp (SEQ ID NO:1), encoding 179 amino acid residues (SEQ ID NO:2). The target gene was cloned into the prokaryo...

Embodiment 2

[0054] Embodiment 2: Expression of recombinant rGT-4

[0055] pET-22b-gigtIV was transformed into Escherichia coli BL21 (purchased from Novagen). SDS-PAGE electrophoresis analysis of the supernatant of genetically engineered bacteria sonication showed that the bacteria had obvious specific expression product bands after induction, and the molecular weight was consistent with the predicted theoretical value of 19.7kD ( figure 2 ).

[0056] After exploring the cultivation time, induction concentration, temperature and other conditions, and comparing the induced expression of the bacteria after expanding the culture for different periods of time, the final culture conditions for the genetically engineered bacteria were as follows: a single colony was inoculated in 50ml of ampicillin-resistant LB liquid medium ( 1% (w / v) tryptone, 0.5% (w / v) yeast extract, 1% (w / v) sodium chloride), culture overnight at 37°C, 180rpm, take 20ml of overnight culture and inoculate 2L Ampicillin-re...

Embodiment 3

[0057] Embodiment 3: Purification of recombinant rGT-4 protein

[0058] The harvested total bacteria were washed with PBS buffer (10mmol / L, pH 7.5), then suspended with solution A (20mmol / L PBS, 500mmol / LNaCl, 20mmol / L imidazole, pH 7.4), and after ultrasonic treatment, centrifuged ( 4°C, 12000rpm, 30min), the supernatant was Ni 2+ One-step purification by affinity chromatography.

[0059] The column was pre-equilibrated with solution A. After loading the sample, use solution B (20mmol / L PBS, 500mmol / LNaCl, 500mmol / L imidazole, pH 7.4) for gradient elution, the elution time of each gradient is 10min, and the flow rate is 1ml / min. Recombinant rGT-4 was eluted in 20% B solution ( image 3 ), store rGT-4 at -75°C. Another small amount was taken for SDS-PAGE analysis, showing that its molecular weight was about 19KD and the purity reached more than 90% ( figure 2 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of marine organisms, in particular to a recombinant expression method of actinoporins proteins. Actinoporins are of proteins with the molecular weight of 20kDa and have very extensive physiological activity. At present, a main method for getting actinocongestin proteins is realized by separation and purification of sea anemone tentacle proteins. The invention provides the recombinant expression method of the actinoporin proteins, and the actinoporin proteins obtained by the recombinant expression method disclosed by the invention have the advantages of biological activity and high purity. The invention further discloses application of the actinoporin proteins in preparation of medicaments for preventing or treating tumors.

Description

technical field [0001] The invention relates to the technical field of marine biology, in particular to a recombinant expression method of sea anemone cytolysin protein. Background technique [0002] There are many kinds of peptide toxins in marine organisms. These toxins have unique properties and have a wide range of biological activities such as nervous system activity, cardiovascular system activity and cell activity. They are widely used in the research and application of biomedicine, molecular biology and pharmacy. There are broad prospects. In recent years, sea anemone toxins have received more attention due to their novel structure, specific target sites, and high efficiency of action. [0003] The tentacles and body of sea anemones contain a large number of nematocysts, each of which has a special sac-shaped organelle called nematocyst, which stores venom, and the nematocyst is coiled in the nematocyst. The tip is a needle, and when mechanically or chemically stim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/12C07K14/435C07K1/22A61K38/17A61P35/00
Inventor张艺馨胡波刘小宇卢小玲高云焦炳华
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY