Method for detecting fungal pathogens

A pathogenic, fungal technology used in the detection of fungal pathogens

Active Publication Date: 2013-03-13
COUNCIL OF SCI & IND RES
View PDF18 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantage of the available PCR-RFLP based techniques

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting fungal pathogens
  • Method for detecting fungal pathogens
  • Method for detecting fungal pathogens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment -1

[0100] Cultivation of the fungal pathogens used in this study: The following are the growth conditions used for the cultivation of the fungal pathogens of apples.

[0101] Alternaria alternata

[0102] Growth medium - PDA (Potato Dextrose Agar; Himedia); Growth conditions - Aerobic

[0103] Temperature: 28°C; Culture time: 5 days

[0104] Glomerella cingulata

[0105]Growth medium - PDA (Potato Dextrose Agar; Himedia); Growth conditions - Aerobic

[0106] Temperature: 25°C; Culture time: 5 days

[0107] Colletotrichum acutatum

[0108] Growth medium - PDA (Potato Dextrose Agar; Himedia); Growth conditions - Aerobic

[0109] Temperature: 25°C; Culture time: 5 days

[0110] Botrytis cinerea

[0111] Growth medium - PDA (Potato Dextrose Agar; Himedia); Growth conditions - Aerobic

[0112] Temperature: 25°C; Culture time: 5 days

[0113] Apple scab (Venturia inaequalis)

[0114] Growth medium-M-98 (wort juice 10gm / L; peptone 3gm / L and agar 15gm / L; Himedia); growth condit...

Embodiment -2

[0116] Design of universal fungal-specific primers: rDNA sequences of various apple fungal pathogens were downloaded from NCBI (http: / / www.ncbi.nlm.nih.gov). In order to obtain the conserved regions in these sequences, multiple sequence alignments were performed using CLUSTALW2 (http: / / www.ebi.ac.uk / Tools / clustalw2 / index.html). Both the forward primer (ITRRF1: 5'CGATGAAGAACGCAGCGAAAT) and the reverse primer (ITRRRI: TATGCTTAAGTTCAGCGGGTATC) were designed from the conserved region flanking the ITS2 region of the fungal rDNA sequence.

Embodiment -3

[0118] Analysis of the generality of the designed primers: To find out whether the primers designed in this study could amplify the rDNA sequences of other fungi, we downloaded the rDNA sequences of a variety of randomly selected fungi [Debaryomyces hansenii Strain W4682 (GQ913348); Fungal endophyte isolate 5724 (DQ979775); Cladosporium cladosporioides strain STE-U (AY251074); Cladosporium cladosporioides isolate GG6 ( EF 104249); Athelia bombacina isolate AFTOL-ID347 (DQ449026); Chaetomium globosum isolate B221 (GQ365152); Microsphaeropsis sp. HLS303 (FJ770074; Microsphaeropsis arundinis (Microsphaeropsis arundinis) strain PMBMDF049 (FJ798603); Dothideomycetes sp. 11313 (GQ153229); Aspergillus flavus strain ATCC11497 (GU256760); Aspergillus terreus strain ATCC2056475 (9GU2); Aspergillus niger strain ATCC64973 (GU256750); Aspergillus versicolor strain ATCC26644 (GU256744); Debaryomyces hansenii strain W4682 (GQ913348); Neurospora crassa ) strain ATCC MYA-4619 (GU327635); Neur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Early detection of pathogens during asymptotic stage can be useful for timely need based adoption of available methodologies to prevent establishment of the disease and associated yield loss. Beside this, it would be useful for predicting crop productivity and monitoring presence of pathogens in the samples being traded internationally by quarantine departments. Our innovation of designing universal primer to PCR amplify fungal rDNA sequences, restriction digestion of PCR products with HinFl enzyme and analysis of the restriction fragments through PathDec tool leads identification and detection of almost all the fungal pathogens of apple even before visual appearance of the disease symptoms in less than 6 hours.

Description

[0001] The following description specifically illustrates the present invention and its implementation: technical field [0002] The present invention relates to a universal primer set for the detection and identification of fungal pathogens. [0003] The pathogen detection system developed in this study can be used to distinguish fungal pathogens, even during the asymptomatic stage, to detect fungal pathogens present in orchards, to determine the amount of fungicide basal spray required, and to detect fungal pathogens in orchards during the asymptomatic stage. Estimates of predicted crop yields in the event of severe yield loss. In addition, it can be used for routine monitoring of import and export samples by the quarantine department. Background technique [0004] There are several methods available for the detection of plant and animal fungal pathogens. Most of these methods use the conservation and variability of fungal rDNA sequences to detect pathogens. The rDNA in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/156
Inventor 卡尼卡・塔库尔戈帕尔吉・杰哈
Owner COUNCIL OF SCI & IND RES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap