Kit and method for detecting expression level of TYMS (Thymidylate Synthetase) mRNA (messenger Ribonucleic Acid)

A gene expression and kit technology, applied in the field of kits for detecting TYMS mRNA gene expression, can solve problems such as poor efficacy

Inactive Publication Date: 2013-05-08
周宏灏
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conversely, patients with high expression of TYMS are less effective in receiving fluorine therapy (Yasumatsua R et al. Chemotherapy. 2009;55:36-41.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for detecting expression level of TYMS (Thymidylate Synthetase) mRNA (messenger Ribonucleic Acid)
  • Kit and method for detecting expression level of TYMS (Thymidylate Synthetase) mRNA (messenger Ribonucleic Acid)
  • Kit and method for detecting expression level of TYMS (Thymidylate Synthetase) mRNA (messenger Ribonucleic Acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] In order to make the object, technical solution and advantages of the present invention clearer, preferred embodiments of the present invention are described in detail below.

[0027] 1. Configuration of fluorescent quantitative PCR detection kit for TYMS gene

[0028] The fluorescent quantitative PCR detection kit of the TYMS gene of the present embodiment comprises the following components:

[0029] 1) TYMS gene standard product: recombinant pUC57 vector containing the TYMS gene coding sequence (GeneBank number NM 001071.2 from the 649th to the 728th base);

[0030] 2) Detect the upstream and downstream primers of TYMS gene:

[0031] TYMS-upstream primer: 5'- CAACCCTGACGACAGAAGAATCA -3' (SEQ ID NO.2)

[0032] TYMS-downstream primer: 5'-ATGGCATGGAGGCAGCG-3' (SEQ ID NO.3);

[0033] 3) 5× reverse transcription buffer, reverse transcription primer Oligo-(dT)16 at a concentration of 10 pmol / μl, dNTPs solution at a concentration of 20 pmol / μl, M-MLV reverse transcriptase...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit and method for detecting the expression level of TYMS (Thymidylate Synthetase) mRNA (messenger Ribonucleic Acid). The kit comprises a standard substance and an internal reference gene real-time quantitative PCR (Polymerase Chain Reaction) system, wherein the standard substance is used for making a standard curve. Through the method, the expression level of TYMS can be accurately, rapidly and quantitatively determined. If the method and the kit, disclosed by the invention, are applied in clinic, doctors can rationally select fluorine drugs for treatment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit and method for detecting TYMS mRNA gene expression. Background technique [0002] Fluorouracil (Fluorouracil, 5-FU) is the first anti-metabolite drug and the most widely used anti-pyrimidine drug in clinical practice. It has good curative effect on digestive tract tumors and other solid tumors, and plays an important role in medical oncology treatment. 5-FU itself has no anti-tumor activity, and when it enters the human body, it can be converted into active metabolites: fluorouracil deoxynucleoside monophosphate (FdUMP), fluorouracil deoxynucleoside triphosphate (FdUTP) and fluorouracil triphosphate (FUTP), resulting in antitumor activity. In addition to 5-FU, fluorine drugs also include tegafur, carmofur, floxuridine, deoxyfluridine, and capecitabine. [0003] Thymidylate synthetase encoded by TYMS (Thymidylate Synthetase, TS) gene is the rate-limiting enzyme fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 郭成贤张伟陈小平刘昭前周宏灏
Owner 周宏灏
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap