Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance

A technology for tandem genes and cleavage genes, applied in the field of efficient lysis plasmids and construction methods for effectively cleaving tandem genes, to achieve the effect of reducing lateral transmission and increasing yield

Active Publication Date: 2013-06-12
INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at problems such as low cracking efficiency, low output and unsafe factors in the slough mentioned in the above-mentioned background technology, the present invention provides a kind of bacteriophage PhiX174 High-efficiency cleavage tandem gene composed of mutant cleavage gene mE and staphylococcal nuclease A gene SNA, high-efficiency cleavage plasmid containing the high-efficiency cleavage tandem gene and its construction method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance
  • Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance
  • Efficient splitting tandem gene, efficient splitting plasmid and construction method and appliance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1, Construction of Safe and Efficient Lysis Plasmid pBV-mELS

[0041] 1.1 PCR amplification of mutant cleavage gene E of phage PhiX174

[0042] Primers were designed according to the coding sequence of PhiX174 (GenBank No. J02482.1) cleavage gene E in GenBank, and the mutant cleavage gene E (mE) was amplified by introducing point mutations into the primers. Introduced at the 5' end of primer mE-F Eco R I restriction enzyme site, 15 amino acids (Gly) were introduced at the 5' end of primer mE-R 4 Ser) 3 The sequence is used as a Linker, and the length of the amplified fragment is expected to be 327 bp. The primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the sequences are as follows:

[0043] mE-F: 5'-GC GAATTC TGGTACGCTGGACTTTGTG-3', (see sequence 4 in the sequence listing)

[0044] mE-R: 5'-GC AGAACCACCACCACCAGAACCACCACCACCAGAACCACCACCACC CTCCTTCCGCAC-3', (see sequence 5 in the sequence listing)

[0045] The mutant cleavage...

Embodiment 2

[0055] Embodiment 2, the preparation of safe Escherichia coli DH5α slough

[0056] 2.1 Induced expression of highly efficient cleavage tandem gene mE-L-SNA

[0057] Inoculate Escherichia coli DH5α (pBV-mELS) monoclonals transformed with high-efficiency cleavage plasmids into 5 mL LB medium containing 100 μg / mL ampicillin, culture with shaking at 30°C overnight, and then transfer to 50 mL In LB medium containing 100 μg / mL ampicillin, shake culture at 30°C until OD 600 When the value reached 1.0-1.2, the bacterial culture was rapidly shifted to 42°C to induce the expression of the tandem gene mE-L-SNA. In order to maximize the activity of SNA, a final concentration of 10 mM CaCl was added at 90 min of warming induction 2 and 1 mM MgCl 2 . Samples were taken at intervals before and after induction to measure the OD of the bacterial solution 600 Value and viable count to monitor bacterial growth and lysis. After the end of the induction, the slough formed was washed with P...

Embodiment 3

[0065] Embodiment 3, the lytic activity comparison of plasmid pBV-mELS and pBV-mE

[0066] 3.1 Construction of lysis plasmid pBV-mE

[0067] Apply primers mE-F and mE-R' (5'-CT GTC GAC TCACTCCTTCCGCACGTA -3') (introduced at the 5' end Sal Ⅰ restriction enzyme cutting site), using PhiX174 RFI DNA as a template to amplify the mutant cleavage gene E by PCR, and apply it Eco R I and Sal Insert the plasmid pBV220 after double digestion with I restriction endonuclease, and then transform Escherichia coli DH5α competent cells. Positive clones identified by enzyme digestion were then identified by sequencing. The plasmid with the correct sequence is the pBV-mE plasmid.

[0068] 3.2 Comparison of cleavage kinetics of plasmids pBV-mELS and pBV-mE

[0069] The method of inducing lysis of Escherichia coli DH5α (pBV-mE) is basically the same as that of Escherichia coli DH5α (pBV-mELS), the only difference is that Escherichia coli DH5α (pBV-mE) does not need to add CaCl during ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of genetic engineering, in particular to an efficient splitting tandem gene which is composed of a phage PhiX174 mutation splitting gene mE and a staphylococcus nuclease A gene SNA, an efficient splitting plasmid which contains the efficient splitting tandem gene and appliance of the efficient splitting plasmid in preparation of ghost, and a gene sequence is shown as a sequence 3 in a sequence list. A structured safe and efficient splitting plasmid pBV-mELS is capable of conducting induction when an Escherichia coli liquid OD600 value reaches more than 1.0. Splitting efficiency can be 99.99995%. Not only is limitation that a splitting gene E mediated fragmentation process relies on a growing state (OD600 is 0.4 to 0.6) of host bacteria broken through, output of the ghost is greatly improved, but also heritage materials left in the ghost is effectively eliminated, and side-direction spread of a perniciousness heredity element (an antibiotics resistance gene and a pathogenic determinant cluster gene) is reduced.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to a high-efficiency cleavage tandem gene composed of bacteriophage PhiX174 mutant cleavage gene mE and staphylococcal nuclease A gene SNA, a high-efficiency cleavage plasmid containing the high-efficiency cleavage tandem gene and a construction method, and also relates to the Describe the application of high-efficiency cleavage plasmids in the preparation of sludges. Background technique [0002] Bacterial Ghosts (BGs) are complete bacterial empty shells formed after Gram-negative bacteria are cleaved by cleavage protein E of bacteriophage PhiX174. Cleavage protein E is a hydrophobic transmembrane protein composed of 91 amino acids, which does not have any enzymatic activity itself, but can mediate the formation of transmembrane channels through oligomerization. After the pores are formed, most of the cytoplasmic content of Gram-negative bacteria is discharged from the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/62C12N15/63C12N15/66C12N1/21
Inventor王金宝张玉玉吴家强王可杜以军李俊于江彭军
OwnerINST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI