Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of stilbene compounds in treating and preventing AIDS

A technology of stilbenes and compounds, applied to active ingredients of hydroxyl compounds, antiviral agents, etc.

Inactive Publication Date: 2013-06-19
TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on the inhibition of stilbene compounds on HIV protease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of stilbene compounds in treating and preventing AIDS
  • Application of stilbene compounds in treating and preventing AIDS
  • Application of stilbene compounds in treating and preventing AIDS

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Expression, purification, protein activity detection and IC of HIV-1 protease 50 Determination of value

[0039] (1) Amplification of HIV-1 protease fragment and construction of expression vector

[0040] Design primer PCR to amplify the HIV-1 protease coding fragment, recover the PCR product and pET-11a vector and digest it with Nde I and BamH I, recover the target fragment, connect the digested fragment with the linearized vector and transform E. coli.DH5α competent cells. The transformed clones were picked for PCR identification, and the positive clones were subjected to DNA sequencing.

[0041] Gene sequence of HIV-1 protease:

[0042] cctcagatcactctttggcaacgaccccctcgtcacaataaagataggggg

[0043] gcaactaaaggaagctctattagatacaggagcagatgatacagtattag

[0044] aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat

[0045] tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg

[0046] cggacataaagctataggtacagtattaggtaggacctacacctgtcaacat

[0047] aattggaagaaatct...

Embodiment 2

[0054] Example 2 Isolation of HIV-1 protease inhibitors from sausage beans

[0055] 30 grams of 95% ethanol extract of sausage bean was dispersed with 1.4 times of double-distilled water for 2 hours, poured into a separatory funnel, and extracted with petroleum ether, dichloromethane, ethyl acetate and n-butanol in sequence , fully shaken, left to stand for 6 hours, extracted 3 times with each solvent, separated the organic phase and the aqueous phase, and the extract was concentrated with an EYELA N1001 rotary evaporator, and the obtained dry paste sausage soya bean ether, dichloromethane, Ethyl acetate and n-butanol extraction samples, as HIV protease inhibitors in vitro screening and separation samples.

[0056] The inhibitory effect of the extracts of the above four solvents on HIV protease was tested at a drug concentration of 0.5mg / ml, and it was found that the ethyl acetate extract had better inhibitory activity, so the ethyl acetate extract was selected as the next ste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Inhibitory activityaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of stilbene compounds in treating and preventing AIDS. The stilbene compounds have a structural formula represented by the general formula (I), wherein R1, R2, R3, R4, R5 or R6 independently represents hydrogen, hydroxyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 acyloxy, halogen, nitro, trifluoromethyl, or cyano, provided that at least one of R1, R2 and R3 is hydroxyl and at least one of R4, R5 and R6 is hydroxyl. In the compounds represented by the general formula (I), the inhibition activity IC50 of a stilbene compound piceatannol against HIV-1 protease reaches 59mum.

Description

technical field [0001] The present invention relates to the field of medicinal chemistry, in particular to the use of stilbene compounds. Background technique [0002] Acquired Immune Deficiency Syndrome (AIDS for short), also known as AIDS, is an infectious disease caused by the Human Immunodeficiency Virus (HIV). HIV virus is a virus that can attack the human immune system. It targets the most important T4 lymphocytes in the human immune system, engulfs and destroys T4 lymphocytes in large quantities, thereby destroying the human immune system and eventually causing the immune system to collapse. It makes the human body fall ill due to the loss of resistance to various diseases, resulting in various infections or tumors, and finally leads to death. [0003] The harm of AIDS has swept the world, and the spread is very rapid. In 1984, there were less than 3,000 reported AIDS patients worldwide. According to the "2008 AIDS Epidemic Report" released by UNAIDS, by the end of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/05A61P31/18
Inventor 饶子和杨诚李金楠张坛杰冯金磊唐延婷郭宇陈卫强
Owner TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products