Salt resistance related protein IbEST of sweet potato and coding gene and application thereof
A technology related to protein and protein, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems affecting food production and restrictions, and achieve the effect of broad application space and market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1. Obtaining the protein IbEST and its coding gene related to salt tolerance of sweet potato
[0046] 1. Obtaining the protein IbEST and its coding genes related to salt tolerance
[0047] Experimental material: Sweet potato salt-tolerant mutant LM79 (the public can obtain it from China Agricultural University. The non-patent document that records this material is: He Shaozhen. In vitro screening of sweet potato salt-tolerant mutants and cloning of salt-tolerant candidate genes. China Agricultural University Doctoral dissertation, 2008;) The unfolded leaves of the sterile seedlings were removed, and the leaves were quick-frozen in liquid nitrogen and stored at -80°C.
[0048] 1. Extraction and purification of total RNA from leaves
[0049] Take about 2g of the unfolded leaves of the LM79 sterile seedlings, grind them into powder in liquid nitrogen, add them to a 10mL centrifuge tube, and use the Applygen Plant RNA Extraction Kit (Applygen Technologies Inc, Beijing) to e...
Embodiment 2
[0073] Example 2. Application of IbEST protein in improving plant salt tolerance
[0074] 1. Obtaining tobacco transfer to IbEST
[0075] 1. Construction of recombinant vector pCBIbEST
[0076] According to the coding sequence of the sweet potato IbEST protein cDNA, a primer sequence was designed to amplify the complete coding sequence. The forward and reverse primers were introduced into the BamH I and Sac I restriction sites respectively. The primer sequences are as follows:
[0077] Primer 11: 5' GGATCC ATGAAAGGCGTCTTCTCGG’ (sequence 5) (the underlined part is the BamH I restriction site),
[0078] Primer 12: 5’ GAGCTC CTATACTAAGTTTCTAAATTCCAAGCAA3' (sequence 6) (the underlined part is the Sac I restriction site).
[0079] Take the DNA molecule shown in sequence 1 in the artificially synthesized sequence table as a template (or use LM79cDNA as a template), use primer 11 and primer 12 for PCR amplification to obtain a 1245 bp PCR product, which is ligated to the pGEM-TEasy vector ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com