Salt resistance related protein IbEST of sweet potato and coding gene and application thereof

A protein and coding technology, applied in sweet potato salt-tolerance-related protein IbEST and its coding gene and application fields, can solve problems such as affecting food production and restrictions, and achieve the effect of broad application space and market prospect.

Inactive Publication Date: 2014-06-25
CHINA AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existence of large areas of salinized land has seriously affected food production and has become the main factor restricting agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the acquisition of protein IbEST and its coding gene related to sweet potato salt tolerance

[0046] 1. Acquisition of salt-tolerance-related protein IbEST and its coding gene

[0047] Experimental material: Sweet potato salt-tolerant mutant LM79 (the public can obtain it from China Agricultural University. The non-patent literature that has recorded this material is: He Shaozhen. In vitro screening of sweet potato salt-tolerant mutants and cloning of salt-tolerant candidate genes. China Agricultural University Doctoral dissertation, 2008;) The expanded leaves of sterile seedlings were removed, quick-frozen in liquid nitrogen, and stored at -80°C.

[0048] 1. Extraction and purification of total RNA from leaves

[0049]Take about 2 g of the expanded leaves of LM79 sterile seedlings, grind them into powder in liquid nitrogen, put them into a 10 mL centrifuge tube, and extract total RNA from sweet potato leaves with the Applygen Plant RNA Extraction Kit (Ap...

Embodiment 2

[0073] Embodiment 2, the application of IbEST protein in improving plant salt tolerance

[0074] 1. Acquisition of trans IbEST tobacco

[0075] 1. Construction of recombinant vector pCBIbEST

[0076] According to the coding sequence of the sweet potato IbEST protein cDNA, the primer sequences for amplifying the complete coding sequence were designed, and the forward and reverse primers were respectively introduced into BamH I and Sac I restriction sites. The primer sequences were as follows:

[0077] Primer 11: 5' GGATCC ATGAAAGGCGTCTTCTCGG' (sequence 5) (the underlined part is the BamH I restriction site),

[0078] Primer 12: 5' GAGCTC CTATACTAAGTTTCTAAATTCCAAGCAA3' (SEQ ID NO: 6) (the underlined part is the Sac I restriction site).

[0079] Using the DNA molecule shown in Sequence 1 in the artificially synthesized sequence listing as a template (or LM79cDNA as a template), PCR amplification was performed with primers 11 and 12 to obtain a 1245bp PCR product, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a salt resistance related protein IbEST of a sweet potato and a coding gene thereof and application thereof. The protein related to salt resistance of the sweet potato provided by the invention is named IbEST, comes from Ipomoea batatas and is shown in (a) or (b) below: (a) the protein composed of amino acid sequences shown as a sequence 2 in a sequence list; and (b) the protein derived by the sequence 2 by replacing, deleting and / or adding residual acids of one or multiple amino acids in the amino acid sequence as shown by the sequence 2 in the sequence list and related to the stress tolerance of a plant. The experiment proves that the IbEST gene and the coding protein play an important role in the process of withstanding abiotic stress by the plant. The IbEST protein and coding gene provided by the invention have an important application value in the research of improving the salt tolerance of the plant. The salt resistance related protein IbEST of the sweet potato and coding gene have wide application space and market foreground in the agricultural field.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a sweet potato salt-tolerance-related protein IbEST and its coding gene and application. Background technique [0002] There are large areas of salinized land in the world. According to statistics, there are 3.8×10 8 hm 2 In saline-alkali land, there is secondary salinized land accounting for 33% of the cultivated land in irrigated areas. Soil salinization seriously affects the development of modern agriculture. As far as our country is concerned, nearly one-tenth of the 1.8 billion mu of cultivated land in the country is secondary salinized land, and there are also 2×10 7 hm 2 Saline wasteland. The existence of a large area of ​​salinized land has seriously affected food production and has become the main factor restricting agricultural production. Through in-depth research on the mechanism of plant salt tolerance, cultivating new varieties of salt-tolerant crops is one of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/11C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 刘庆昌翟红何绍贞王连军刘德高
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap