Oxygenase gene caceO as well as coded protein and application of oxygenase gene
An oxygenase and gene technology, applied in the field of applied environmental microorganisms and agriculture, can solve problems such as crop phytotoxicity, endangering human health, and destroying the ecological environment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1. Cloning of acetochlor degradation gene (see the strategy diagram figure 1 )
[0040] 1.1 Obtaining mutant DC-2MUT
[0041] The water solubility of acetochlor at room temperature is 225mg / kg, so the LB plate containing 400mg / kg of acetochlor produces turbidity, and the wild strain DC-2 (CCTCC NO: M2012190) is streaked on the LB plate (containing 400mg / kg of acetochlor) (Amine) when incubated at 30°C, a transparent circle will appear. This is a simple way to judge the degradation of acetochlor with the naked eye. However, after many passages, it was found that a colony did not produce a transparent circle around it. Select this colony into 100ml LB liquid medium, after the strain is cultured to the late logarithmic stage, wash it with 6,000 centrifugal distilled water twice, and resuspend to 20ml (containing 100mg / kg acetochlor) inorganic salt to verify the effect. The results showed that it lost the function of degrading acetochlor and named this strain DC-2MUT (...
Embodiment 2
[0061] Example 2 Technical roadmap for functional verification of oxygenase gene caceO (see the strategy diagram figure 2 )
[0062] 2.1 Extraction of genomic DNA from strain DC-2
[0063] Same as 1.1
[0064] 2.2 PCR amplification of 1.2K nucleic acid fragment containing caceO gene
[0065] With forward primer: 5- CGGGATCCCG GCCAGTTCCGCCGCCCCAAAATCCA (SEQ ID NO.3) is underlined with EcoRI restriction site and reverse primer: A2:5- CGGAATTCCG CTACCCCGCCGACACAGCGACGACC (SEQ ID NO.4) underlined the BamH I restriction site as a primer. PCR was used to amplify 1.2K-caceO from Sphingobium DC-2 (CCTCCNO: M2012190) genomic DNA.
[0066] Amplification system:
[0067]
[0068] PCR amplification program:
[0069] a. Denaturation at 98°C for 1 min;
[0070] b. Denaturation at 98°C for 15s, annealing at 53°C for 15s, and extension at 72°C for 70s, for 30 cycles;
[0071] c. Extend at 72°C for 10 minutes and cool to room temperature.
[0072] 2.3 The PCR product was double digested with BamH I and E...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 