Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Oxygenase gene caceO as well as coded protein and application of oxygenase gene

An oxygenase and gene technology, applied in the field of applied environmental microorganisms and agriculture, can solve problems such as crop phytotoxicity, endangering human health, and destroying the ecological environment

Active Publication Date: 2013-08-21
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, the residual pollution of chlorinated acetamide herbicides in the soil and water environment seriously endangers human health, destroys the ecological environment and has serious phytotoxicity to crops.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Cloning of acetochlor degradation gene (see the strategy diagram figure 1 )

[0040] 1.1 Obtaining mutant DC-2MUT

[0041] The water solubility of acetochlor at room temperature is 225mg / kg, so the LB plate containing 400mg / kg of acetochlor produces turbidity, and the wild strain DC-2 (CCTCC NO: M2012190) is streaked on the LB plate (containing 400mg / kg of acetochlor) (Amine) when incubated at 30°C, a transparent circle will appear. This is a simple way to judge the degradation of acetochlor with the naked eye. However, after many passages, it was found that a colony did not produce a transparent circle around it. Select this colony into 100ml LB liquid medium, after the strain is cultured to the late logarithmic stage, wash it with 6,000 centrifugal distilled water twice, and resuspend to 20ml (containing 100mg / kg acetochlor) inorganic salt to verify the effect. The results showed that it lost the function of degrading acetochlor and named this strain DC-2MUT (...

Embodiment 2

[0061] Example 2 Technical roadmap for functional verification of oxygenase gene caceO (see the strategy diagram figure 2 )

[0062] 2.1 Extraction of genomic DNA from strain DC-2

[0063] Same as 1.1

[0064] 2.2 PCR amplification of 1.2K nucleic acid fragment containing caceO gene

[0065] With forward primer: 5- CGGGATCCCG GCCAGTTCCGCCGCCCCAAAATCCA (SEQ ID NO.3) is underlined with EcoRI restriction site and reverse primer: A2:5- CGGAATTCCG CTACCCCGCCGACACAGCGACGACC (SEQ ID NO.4) underlined the BamH I restriction site as a primer. PCR was used to amplify 1.2K-caceO from Sphingobium DC-2 (CCTCCNO: M2012190) genomic DNA.

[0066] Amplification system:

[0067]

[0068] PCR amplification program:

[0069] a. Denaturation at 98°C for 1 min;

[0070] b. Denaturation at 98°C for 15s, annealing at 53°C for 15s, and extension at 72°C for 70s, for 30 cycles;

[0071] c. Extend at 72°C for 10 minutes and cool to room temperature.

[0072] 2.3 The PCR product was double digested with BamH I and E...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oxygenase gene caceO as well as coded protein and application of the oxygenase gene caceO. The sequence of the cloned oxygenase gene caceO is shown in SEQ ID NO.1, and the sequence of a coded product CaceO is shown in SEQ ID NO.2. The CaceO can catalyze the hydrolysis of acetochlor to generate 2-chloro-N-(2-ethyl-6-methyl phenyl) acetamide, and can catalyze the hydrolysis of alachlor and butachlor to generate 2-chloro-N-(2,6-diethyl phenyl) acetamide. The CaceO can be constructed for degrading acetochlor, alachlor and butachlor to obtain transgenic crops which are capable of resisting the herbicides, eliminating acetochlor, alachlor and butachlor residues in soil and a water body, and for the biotransformation of chemical products, thus having quite important theoretical and application values.

Description

Technical field [0001] The invention belongs to the field of applied environmental microorganisms and agriculture, and relates to an oxygenase gene caceO and its encoded protein and applications. Background technique [0002] While the use of herbicides reduces agricultural labor intensity and ensures normal agricultural production, their residues also cause serious crop phytotoxicity problems. According to statistics, my country’s annual farmland area affected by herbicide phytotoxicity reaches 30 million mu, of which serious phytotoxicity The area reaches 5 million mu, causing billions of yuan in losses every year, and herbicide-resistant genetic modification is the best way to solve herbicide damage. Chloroacetamide herbicides are highly effective and selective contact herbicides, which have a very significant effect on grass weeds. Chloroamide herbicides are currently one of the most widely used herbicides in the world. As of 2007, the annual output and use area were second o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N1/21A62D3/02B09C1/10C02F3/00C12R1/19C12R1/01A62D101/04A62D101/28C02F101/38
CPCA62D3/02A62D2101/04A62D2101/22A62D2101/28C12N9/0004
Inventor 何健陈青李怡闫新蒋建东洪青黄星李顺鹏朱建春
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com