Preparation method and application of nucleic acid fingerprint characteristic spectrum based on bacteria of 16S rDNA
A fingerprint feature, bacterial nucleic acid technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high detection cost, long time, difficult to distinguish, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] Example 1. The establishment of a single bacterial nucleic acid fingerprint feature map
[0085] 1. Design and select universal primers
[0086] According to the conserved region (SEQ ID No: 3) of the 16S rDNA of Listeria monocytogenes (Listeria monocytogenes EGD-e, NCBI accession number: NC_003210.1), design universal PCR primers, respectively:
[0087] 5-aggaagagagAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)
[0088] 5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)
[0089] Among them, the sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the 16S rDNA region to be amplified, and aggaagagag and cagtaatacgactcactatagggagaaggct are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains 10 bp in order to transcribe the PCR product The tag (aggaagagag), the 5' end of the primer of SEQ ID No: 2 contains a 31bp tag (cagtaatacgactcactatagggagaaggct). Relevant pri...
Embodiment 2
[0102] Example 2, small-scale verification of the preparation method of the nucleic acid fingerprint characteristic map of implementation 1
[0103] Using the method and primers described in Example 1, Acetobacter pasteurianus IFO3283-01 and Azorhizobium caulinodans ORS571chromosome were digested and identified by mass spectrometry.
[0104] Repeat twice to get the same nucleic acid fingerprint feature spectrum, where figure 2 , image 3 The nucleic acid fingerprint characteristic maps of Acetobacter and nitrogen-fixing rhizobia are shown respectively.
Embodiment 3
[0105] Embodiment 3, the establishment of the nucleic acid fingerprint feature map library of bacteria
[0106] According to the method and primers described in Example 1, the bacteria listed in Table 1 were digested and identified by mass spectrometry, and the nucleic acid fingerprints of all bacteria were obtained.
[0107] These feature maps are integrated and analyzed by Bioexplore software to obtain a nucleic acid fingerprint feature map library including most bacteria.
[0108] As shown in table 2, Figure 4 - Figure 100 The nucleic acid fingerprint feature maps of 97 kinds of bacteria are displayed respectively.
[0109]
[0110]
[0111]
[0112] Table 2 (Note: Table 2 is the content in italics in Table 1)
[0113] Figures 101-103 It is the nucleic acid fingerprint characteristic map of sheep, cattle, and suis Brucella, Figure 104 It is the nucleic acid fingerprint characteristic map of Mycobacterium tuberculosis, Figure 105 It is the nucleic acid fing...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 