Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method and application of nucleic acid fingerprint characteristic spectrum based on bacteria of 16S rDNA

A fingerprint feature, bacterial nucleic acid technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high detection cost, long time, difficult to distinguish, etc.

Active Publication Date: 2013-10-23
BIOYONG TECH
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sequencing method is applied to clinical detection, and there are currently the following problems: (1) high cost; (2) time-consuming; (3) for mixed samples, sequencing is prone to overlapping peaks, which is difficult to effectively distinguish; (4) the full length of 16S rDNA is 1.5 More than kb, it generally needs to be sequenced twice and the results are spliced, which is easy to introduce errors in this process
[0013] As mentioned above, 16S rDNA is of great significance to the classification and identification of bacteria, but traditional sequencing and other methods are costly and time-consuming; for samples with mixed infections, the sequencing method will obtain mixed sequence peaks, which is difficult to effectively distinguish. And the use of mass spectrometry for analyte analysis requires selection of suitable analytes and optimization of mass spectrometry parameters. Therefore, new bacterial classification techniques (such as mass spectrometry) are currently needed to achieve fast, accurate, cheap and convenient classification results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of nucleic acid fingerprint characteristic spectrum based on bacteria of 16S rDNA
  • Preparation method and application of nucleic acid fingerprint characteristic spectrum based on bacteria of 16S rDNA
  • Preparation method and application of nucleic acid fingerprint characteristic spectrum based on bacteria of 16S rDNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1. The establishment of a single bacterial nucleic acid fingerprint feature map

[0085] 1. Design and select universal primers

[0086] According to the conserved region (SEQ ID No: 3) of the 16S rDNA of Listeria monocytogenes (Listeria monocytogenes EGD-e, NCBI accession number: NC_003210.1), design universal PCR primers, respectively:

[0087] 5-aggaagagagAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)

[0088] 5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0089] Among them, the sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the 16S rDNA region to be amplified, and aggaagagag and cagtaatacgactcactatagggagaaggct are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains 10 bp in order to transcribe the PCR product The tag (aggaagagag), the 5' end of the primer of SEQ ID No: 2 contains a 31bp tag (cagtaatacgactcactatagggagaaggct). Relevant pri...

Embodiment 2

[0102] Example 2, small-scale verification of the preparation method of the nucleic acid fingerprint characteristic map of implementation 1

[0103] Using the method and primers described in Example 1, Acetobacter pasteurianus IFO3283-01 and Azorhizobium caulinodans ORS571chromosome were digested and identified by mass spectrometry.

[0104] Repeat twice to get the same nucleic acid fingerprint feature spectrum, where figure 2 , image 3 The nucleic acid fingerprint characteristic maps of Acetobacter and nitrogen-fixing rhizobia are shown respectively.

Embodiment 3

[0105] Embodiment 3, the establishment of the nucleic acid fingerprint feature map library of bacteria

[0106] According to the method and primers described in Example 1, the bacteria listed in Table 1 were digested and identified by mass spectrometry, and the nucleic acid fingerprints of all bacteria were obtained.

[0107] These feature maps are integrated and analyzed by Bioexplore software to obtain a nucleic acid fingerprint feature map library including most bacteria.

[0108] As shown in table 2, Figure 4 - Figure 100 The nucleic acid fingerprint feature maps of 97 kinds of bacteria are displayed respectively.

[0109]

[0110]

[0111]

[0112] Table 2 (Note: Table 2 is the content in italics in Table 1)

[0113] Figures 101-103 It is the nucleic acid fingerprint characteristic map of sheep, cattle, and suis Brucella, Figure 104 It is the nucleic acid fingerprint characteristic map of Mycobacterium tuberculosis, Figure 105 It is the nucleic acid fing...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a nucleic acid fingerprint spectrum of bacteria 16S rDNA. The method comprises the following steps of: performing polymerase chain reaction (PCR) amplification, performing SAP enzymatic digestion, performing transcription and nucleic acid enzyme digestion, purifying, performing mass spectrometer detection and the like. Based on the method, a nucleic acid fingerprint spectrum database of common bacteria is constructed. The bacteria to be detected are classified and identified according to the mass spectrum picture map generated through an experiment, and the result can be widely applied to the fields of bacteria classification and identification, evolutionary genetics analysis, drug screening resistant application and import and export inspection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing bacterial nucleic acid fingerprints and a method for classifying and identifying bacteria using the method. Background technique [0002] The early bacteriological classification mainly adopted the traditional bacteriological classification method based on morphological and cultural characteristics and physiological and biochemical characteristics. However, because the surface characteristics of bacteria are often affected and limited by many human factors, especially the differences in people's subjective judgments, it is difficult to reflect the natural kinship of bacteria, which reflects the fact that bacteria are only based on morphological characteristics and physiological and biochemical characteristics. limitations of traditional taxonomies. [0003] Therefore, Colweel proposed a new bacterial taxonomy term "Polyphasic taxonomy", which refers to the metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 张学记马庆伟赵洪斌张海燕赵艳梅
Owner BIOYONG TECH