Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pantoea dispersa and application thereof

A technology for dispersing Pantoea and bacterial strains, applied in the direction of application, bacteria, fertilizer mixture, etc., can solve complex problems and achieve the effect of improving utilization rate, yield and quality

Inactive Publication Date: 2013-11-20
湖北明达科技有限公司
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mechanism of bacterial phosphorus dissolution is very complicated. Some bacteria dissolve phosphorus mainly by protons, some mainly by organic acids, while some strains have both mechanisms, and some strains produce other chelating substances during the growth process, thus lead to the dissolution of phosphate rock powder

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pantoea dispersa and application thereof
  • Pantoea dispersa and application thereof
  • Pantoea dispersa and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Screening and isolation of the highly efficient phosphorus-solubilizing bacterium Pantoea disperses (P.dispersais) pt1

[0023] The P. dispersais pt1 of the present invention is obtained by separating from soil by dilution plate method and plate streak method, and the separation method is as follows: screening by using Montina inorganic phosphorus solid medium. Soil sample collection, the sample collection location is Honghu City, Hubei Province, and the sampling time is February 13, 2013. The 5-point sampling method is used to collect the appropriate amount of soil within the range of 10-20cm around the plot and the central part. Mix well. Indicate the location, time and person of the collection. Weigh 1g of soil sample into 100mL of sterile water, place in a shaker at 30°C at 150r / m for 30min, take 100μL of 10 -2 、10 -3 、10 -4 Spread the diluted solution on the Montina inorganic phosphorus solid medium plate, and apply three parallels for each gradient....

Embodiment 2

[0026] Example 2: Strain identification of the efficient phosphorus-solubilizing bacterium Pantoea disperses (P.dispersais) pt1

[0027] (1) Microbiological characteristics: On NA medium, when cultured at 30°C, the colony is round, smooth around, slightly raised, pale yellow, moist, and slightly transparent. The bacteria are straight rod-shaped, (0.5~1.0) μm×(1.0~3.0) μm, negative for Gram staining, with perinatal flagella, no capsule, no spore production, negative oxidase, can use citrate, no sports.

[0028] (2) Molecular biological characteristics

[0029] The results of the 16s rDNA gene sequence determination of the strain are as follows (SEQ No.1):

[0030]ATGCAAGTCGGACGGTAGCACAGAAGAGCTTGCTCTTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGCGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCACGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCAC...

Embodiment 3

[0031] Example 3 Determination of Phosphorus Solubilizing Ability of Efficient Phosphorus Solubilizing Bacteria P.dispersais pt1

[0032] The phosphate solubilizing ability of phosphate solubilizing bacteria was measured by Montina inorganic phosphorus liquid medium. First, inoculate the disperse Pantoea (P. Shake culture in a constant temperature shaker for 12 hours, then inoculate the cultured bacterial solution into a 250mL triangular flask containing 100mL Montina inorganic phosphorus liquid medium at a 1% inoculum volume (v / v) to inoculate 1% sterile NB liquid medium to Montina inorganic phosphorus liquid medium was used as blank control, and cultured at 30°C and 180r / min in a constant temperature shaker for 7 days.

[0033] The molybdenum-antimony anti-colorimetric method was used to measure the available phosphorus content in the fermentation broth. The higher the available phosphorus content in the fermentation broth of the phosphate-solubilizing bacteria, the stronger...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pantoea dispersa and an application thereof. The strain is pantoea dispersa pt1, and the collection number of the strain is CGMCC No. 7595. The invention further discloses a microbial agent containing the strain and a preparation method. Experiments show that a P. dispersais pt1 fermentation solution contains a large quantity of phosphate solubilizing bacteria, so that the pantoea dispersa pt1 has a certain positive effect on soil improvement, and the phosphate solubilizing function of the pantoea dispersa pt1 has important significance in the aspects of improving the utilization rate of a phosphate fertilizer and improving the yield and quality of crops.

Description

technical field [0001] The invention belongs to the field of phosphorus-dissolving microbial fertilizers. Specifically, the present invention relates to a high-efficiency phosphorus-solubilizing bacterium Pantoea disperse and its application, as well as an inoculant prepared by using the Pantoea disperse. Background technique [0002] Phosphorus is one of the three major nutritional elements necessary for plant growth and development. Phosphorus is the basic constituent element of genetic material DNA and energy material ATP in plant cells. Phosphorus plays an important role in the entire life process of plants. High-energy phosphate bonds are The carrier of energy, the photosynthesis of plants and the biochemical processes in the body must all have phosphorus to participate. Phosphorus is not only an important material guarantee for agricultural production, but also a non-renewable mineral resource. The mass fraction of total phosphorus in the cultivated land soil in my c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C05G3/00C12R1/01
Inventor 牛赡光杨光菊田龙军邓松华杨治家
Owner 湖北明达科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com