Pantoea dispersa and application thereof
A technology for dispersing Pantoea and bacterial strains, applied in the direction of application, bacteria, fertilizer mixture, etc., can solve complex problems and achieve the effect of improving utilization rate, yield and quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Screening and isolation of the highly efficient phosphorus-solubilizing bacterium Pantoea disperses (P.dispersais) pt1
[0023] The P. dispersais pt1 of the present invention is obtained by separating from soil by dilution plate method and plate streak method, and the separation method is as follows: screening by using Montina inorganic phosphorus solid medium. Soil sample collection, the sample collection location is Honghu City, Hubei Province, and the sampling time is February 13, 2013. The 5-point sampling method is used to collect the appropriate amount of soil within the range of 10-20cm around the plot and the central part. Mix well. Indicate the location, time and person of the collection. Weigh 1g of soil sample into 100mL of sterile water, place in a shaker at 30°C at 150r / m for 30min, take 100μL of 10 -2 、10 -3 、10 -4 Spread the diluted solution on the Montina inorganic phosphorus solid medium plate, and apply three parallels for each gradient....
Embodiment 2
[0026] Example 2: Strain identification of the efficient phosphorus-solubilizing bacterium Pantoea disperses (P.dispersais) pt1
[0027] (1) Microbiological characteristics: On NA medium, when cultured at 30°C, the colony is round, smooth around, slightly raised, pale yellow, moist, and slightly transparent. The bacteria are straight rod-shaped, (0.5~1.0) μm×(1.0~3.0) μm, negative for Gram staining, with perinatal flagella, no capsule, no spore production, negative oxidase, can use citrate, no sports.
[0028] (2) Molecular biological characteristics
[0029] The results of the 16s rDNA gene sequence determination of the strain are as follows (SEQ No.1):
[0030]ATGCAAGTCGGACGGTAGCACAGAAGAGCTTGCTCTTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGCGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCACGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCAC...
Embodiment 3
[0031] Example 3 Determination of Phosphorus Solubilizing Ability of Efficient Phosphorus Solubilizing Bacteria P.dispersais pt1
[0032] The phosphate solubilizing ability of phosphate solubilizing bacteria was measured by Montina inorganic phosphorus liquid medium. First, inoculate the disperse Pantoea (P. Shake culture in a constant temperature shaker for 12 hours, then inoculate the cultured bacterial solution into a 250mL triangular flask containing 100mL Montina inorganic phosphorus liquid medium at a 1% inoculum volume (v / v) to inoculate 1% sterile NB liquid medium to Montina inorganic phosphorus liquid medium was used as blank control, and cultured at 30°C and 180r / min in a constant temperature shaker for 7 days.
[0033] The molybdenum-antimony anti-colorimetric method was used to measure the available phosphorus content in the fermentation broth. The higher the available phosphorus content in the fermentation broth of the phosphate-solubilizing bacteria, the stronger...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
