Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for generating novel induction antibody

An antibody and antigen technology, applied in the fields of immunology and genetic engineering, can solve the problem of low protein antigenicity

Active Publication Date: 2014-01-22
SUPERVIEW BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Finally, some important proteins have low antigenicity, and it is difficult for the body to stimulate the production of specific antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for generating novel induction antibody
  • Method for generating novel induction antibody
  • Method for generating novel induction antibody

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0026] Example 1: Construction of eukaryotic expression vector for fusion antigen protein of APCTS-human VEGF-Mycobacterium tuberculosis cytochrome C oxidase subunit II CtaC

[0027] First, the DNA encoding the fusion protein was synthesized by overlapping PCR (overlapping PCR). The specific method is as follows: figure 2 shown. Unless otherwise specified, all molecular biology experiments in the present invention are performed according to the literature: Green, M.R: Molecular cloning, A Laboratory Manual (4th), Cold Spring Harbor Press, 2012. First synthesize four oligonucleotide primer fragments: (1) 5' ATGTTTTCTCGCATGACCTCGCTCATTATGGGTAACAACTTTCTGCTGTCTTGG 3'; (2) 5' TGGCTCGCGAGGTGTCACCCGCCTCGGCTTGTCACATCT

[0028] 3'; (3) 5' ATCGCTCGAGCTAACCTACGGGCATCGG 3'; (4) 5' ACTGGGTACCATGGACTGGACCTGGATA CTGTTCCTGGTG GCC GCCGCCACACGGGTGCACAGCACCTCGCTCATTATGGGT 3'. Primer (1) contains the coding sequence of APCTS and the coding sequence of 6 amino acid residues at N-te...

example 2

[0059] Example 2: Expression of APCTS-human VEGV-CtaC fusion antigen protein in eukaryotic cells and preparation of VEGF-specific antibody in rabbits by DNA immunization

[0060] 293T cells were cultured in culture dishes in DMEM medium containing 10% fetal calf serum (FCS). When the cell density reaches 70% of the confluency, use the FuGENE® HD transfection reagent kit produced by Roche Company to express the fusion antigen protein eukaryotic expression vector pcDNA3.1-human VEGF fusion constructed in Example 1 according to the instructions Antigen expression plasmids were transfected into 293T cells. Place the transfected 293T cells at 37°C, 5% CO 2 Continue culturing in the incubator for 48 hours. Take out the culture dish, remove the culture supernatant, and wash the culture dish once with PBS. Cells were then lysed with 1×Lamelli loading buffer, ultrasonically disrupted, and the sample was treated at 95°C for 5 minutes; then the precipitate was removed by centrifugat...

example 3

[0063] Example 3 DNA immunization with VEGF fusion antigen protein eukaryotic expression vector to prepare VEGF-specific mouse monoclonal antibody

[0064] The eukaryotic expression vector plasmid expressing VEGF fusion antigen protein was prepared in normal saline at a concentration of 1 mg / ml, and 50 μL of the plasmid was injected intradermally at multiple points in the hind leg muscles and back of Balb / c mice. At the same time, on the 14th day and 28th day after the injection, the plasmid preparation of the same dose was repeatedly injected in the same way. The tail vein blood samples of mice were taken, and the titer of VEGF-specific antibody in serum of immunized mice was determined by ELISA method. When the antibody titer was greater than 1:10000, 3 days before the spleen of the mouse was taken for cell fusion, 293T cells (5×10 6 Cells suspended in 100 μl saline) for booster immunization in the abdominal cavity of mice. Then, according to the conventional method (Har...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for generating a novel induction antibody, which comprises a step of preparing a eukaryotic expression vector expressing fusion antigen protein. The fusion protein consists of four parts of sequences: (1) a signal peptide sequence from a human IgE heavy-chain coded sequence; (2) an antigen protein sequence; (3) an auxiliary sequence from a mycobacterium tuberculosis cytochrome C oxidase subunit II, wherein the sequence can amplify the antibody response of the rat and mice against the antigen protein; and (4) a polypeptide sequence MFSRMTSLIMGN that can be combined with the mice FcrR II (APCTS for short), wherein the sequence can specifically guide the protein antigen to the mice antigen-presenting cell (APC) so as to improve the antigen presenting efficiency. The plasmid expressing the fusion antigen protein is directly injected into the mice muscle or skin, and the mice cells can take in DNA (deoxyribonucleic acid) and the efficiently-expressed fusion antigen protein; and then the animal is stimulated to generate a high-affinity antibody against the antigen protein. The generated antibody after being purified can be applied to the scientific research and clinical diagnosis or treatment; and the antibody secretion cell can be used for preparing a specific monoclonal antibody by use of the hybridoma technology.

Description

technical field [0001] The invention relates to the technical fields of immunology and genetic engineering, in particular to a fusion antigen composed of human IgE heavy chain signal peptide, mouse FcrRII binding polypeptide and specific antigen protein, and Mycobacterium tuberculosis cytochrome C oxidase subunit II auxiliary sequence The protein and its expression vector and DNA immunization with the expression vector to prepare specific antibodies. Background technique [0002] Antibody refers to the immunoglobulin produced by the body's immune system from the proliferation and differentiation of B lymphocytes or memory cells into plasma cells under antigen stimulation, and can specifically bind to the corresponding antigen. By injecting specific antigens into animals, corresponding specific antibodies can be obtained. After the blood of these experimental animals is separated, "polyclonal antibodies" can be obtained in the serum. That is, many different antibodies aga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/85C07K16/22
Inventor 吴炯林峰
Owner SUPERVIEW BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More