18 results about "Antigen stimulation" patented technology

The application provides a CAR-T cell overexpressing an IFITM2 gene, a construction method and application thereof in immune cell therapy, and relates to the technical field of biological medicine.The application takes CD276 as a target, regulates T cell memory differentiation and anti-exhaustion mechanism through overexpression of the IFITM2 gene, so that the treatment effect and persistence of CAR-T cell therapy are improved.The CD276-IFITM2 CAR-T cell constructed in the application has more memory differentiation phenotypes and fewer exhaustion phenotypes compared with the CD276 CAR-T cell, and through inhibition of PD-1 and LAG3, strong anti-exhaustion characteristics are realized.Meanwhile, the CD276-IFITM2 CAR-T cell significantly improves the expression level of IL-2, TNF alpha and IFN gamma under multiple antigen stimulations, and has the ability to continuously produce anti-cancer functional factors.In addition, the CD276-IFITM2 CAR-T cell has more significant tumor inhibition effect compared with the CD276 CAR-T cell.The CD276-IFITM2 CAR-T cell provided in the application can be used for preparing a drug for immune cell therapy.

The invention discloses a modular combined vaccine soluble microneedle patch based on a mechanical interlocking tenon-and-mortise structure as well as a preparation method and application of the modular combined vaccine soluble microneedle patch. According to the combined and spliced micro-needle vaccine patch designed by the invention, synchronous delivery of various vaccines is realized by virtue of a micro-needle technology through fragmented loading and mechanical interlocking'mortise and tenon 'structural design, mutual interference among different vaccines is reduced at the same time, efficient protection can be provided for groups needing multi-vaccine protection by virtue of one-time inoculation, the number of inoculants is reduced, and the immune procedure is simplified; vaccine hesitation is reduced, and inoculation rate is increased; meanwhile, the biosoluble material of the microneedle structure can quickly release antigens in the skin to stimulate immune cells to aggregate so as to enhance the immune effect; the micron-sized needle array (lt; 500 m) acts on the superficial layer of the skin, is painless and can be designed into a self-adhesive patch, so that the inoculation compliance is improved; single-dose inoculation can also reduce medical cost, is suitable for resource-deficient regions, improves accessibility and burdenability, and accelerates establishment of a population immune barrier.

The present invention relates to a tumor-reactive T cell composition obtained by expansion from a patient sample, wherein upon stimulation with tumor cell antigens, the proportion of CD8+CD137+ cells among CD45+ cells in the composition is at least greater than 25%, and / or the proportion of CD45RA+CD62L+ cells in the composition is at least greater than 30%. The present invention further relates to a method for obtaining a tumor-reactive T cell composition by expansion from a patient sample. Tumor-reactive T cells in the composition of the present invention have a high total count, a long lifespan, a high viability rate, and a potent tumor-killing capacity, thereby providing a basis for the use of the composition in tumor therapy.

The invention provides a method for preparing tumor antigen-specific T cells, which comprises the following steps: applying a tumor vaccine carrying a target antigen to an individual to immunize, activate and amplify the target antigen-specific T cells, collecting peripheral blood or single collected blood of the individual to which the vaccine is applied, and separating to obtain peripheral blood mononuclear cells, and co-culturing the obtained PBMC and an antigen stimulant carrying the target antigen so as to further activate and amplify the target antigen specific T cells. Also provided are methods of treating cancer in an individual using such tumor antigen-specific T cells, pharmaceutical compositions and kits for cell-based cancer immunotherapy.

The invention relates to a tuberculosis antigen specific host biomarker for detecting tuberculosis infection and a kit, and belongs to the field of biological medicines. The biomarker comprises IFN gamma, CXCL10, IL-2, IL-3, GBP6, ULBP2, CXCL11, ATP13A3, RHOV, ATP2B1, IL-22 and MMP1 (Metallocin Protein Protein 1). According to the present invention, the specific RD1 region antigen or peptide pool from mycobacterium tuberculosis and the specific RD2 region antigen or peptide pool from mycobacterium tuberculosis are jointly used as the antigen irritants to stimulate peripheral whole blood or peripheral blood mononuclear cells (PBMCs) of an individual to be detected, and then the expression quantity change of the host biomarker before and after the stimulation is detected; the kit can effectively distinguish tuberculosis infected patients from non-tuberculosis infected individuals, can identify and diagnose active tuberculosis and latent tuberculosis infected patients, solves the defects of insufficient sensitivity and limited specificity of the existing diagnostic technology, and has high diagnostic efficiency.

A synthetic cytokine signaling system comprises an engineered cytokine signaling chain encoding a transmembrane polypeptide containing a specific variant intracellular domain of IL9R and an extracellular domain of cytokine receptors such as IL2R [beta], IL4R [alpha], IL7R [alpha], IL9R and IL21R. The engineered cytokine signal chain may be in a self-activating form, or optionally may be in a non-self-activating form, depending on whether the functionally compatible cytokine ligand domain is fused to the N-terminus. In the latter case, the synthetic cytokine signaling system may further comprise an engineered cytokine ligand chain that encodes a corresponding cytokine ligand, which may be membrane-bound or secreted. Immune cells modified with the synthetic cytokine signaling system exhibit improved properties compared to unmodified immune cells, such as zero or reduced dependency on IL-2 when cultured in vitro, enhanced activation after antigen stimulation, enhanced cytotoxicity to target cells, and improved tumor control ability when metastatic in vivo.

The invention provides a CAR-T cell overexpressing an IFITM2 gene, a construction method and application of the CAR-T cell in immune cell therapy, and relates to the technical field of biological medicine. According to the invention, CD276 is taken as a target spot, and the T cell memory differentiation and anti-depletion mechanism is regulated and controlled by overexpressing the IFITM2 gene, so that the treatment effect and durability of the CAR-T cell therapy are improved. Compared with the CD276CAR-T cell, the CD276-IFITM2CAR-T cell constructed by the invention has more memory differentiation phenotypes and less depletion phenotypes, and a relatively strong depletion resistance characteristic is realized by inhibiting PD-1 and LAG3. Meanwhile, the CD276-IFITM2CAR-T cell can obviously improve the expression levels of IL-2, TNF alpha and IFN gamma under the stimulation of multiple antigens, and has the capability of continuously generating anti-cancer functional factors. In addition, compared with the CD276CAR-T cell, the CD276-IFITM2CAR-T cell disclosed by the invention has a more remarkable tumor inhibition effect. The CD276-IFITM2CAR-T cell provided by the invention can be used for preparing a medicine for an immune cell therapy.

The present disclosure provides inducible constructs comprising a transcription initiator and / or a transcription regulator. These constructs can be used to drive gene expression in response to a particular cellular state, such as in the context of antigen stimulation. In some embodiments, these constructs are integrated as part of a regulatory circuit, useful for controlling expression and regulation of cells expressing engineered receptors.

The present application relates to the field of immunodetection technology, and particularly relates to a method for enriching and detecting antigen-specific T cells. The method for enriching antigen-specific T cells comprises the following steps: stimulating a whole blood sample with a specific antigen, and then sorting T cells in the whole blood sample stimulated by the antigen by using an immunomagnetic bead sorting technology to obtain a T cell sample. The method is based on the strategy of stimulating the antigen first and then sorting the cells, and can quickly and accurately separate T cells from a complex cell system of whole blood, effectively avoiding the complicated operation of traditional sorting methods, realizing automatic sorting, simplifying the operation steps, shortening the sorting time, improving the sorting throughput, and better ensuring the accuracy of subsequent cell detection. The T cells obtained by the above enrichment method can be detected by using an ELISPOT method, and the antigen-specific T cells can be accurately detected.

The invention discloses an application of a mitochondrial transcription factor TFAM in a CD20 and CD19 targeted double-target chimeric antigen receptor (CAR) and a CAR-T cell. Specifically, the invention provides a CD20 and CD19 double-target chimeric antigen receptor for expressing a mitochondrial transcription factor TFAM, a nucleic acid molecule of the chimeric antigen receptor, a CAR-T cell for expressing the chimeric antigen receptor and the like. The CAR-T cell disclosed by the invention can be used for remarkably improving the early depletion and functional damage of the T cell under the condition of excessive antigen stimulation, and has a remarkably improved anti-tumor effect.

This application discloses a chimeric antigen receptor T cell based on dual-target joint recognition of target cells, a dual-target chimeric antigen receptor, its preparation method, and its application. The T lymphocytes express a dual-target chimeric antigen receptor on their surface. This dual-target chimeric antigen receptor targets a first target and a second target on the target cell, respectively. The first chimeric antigen receptor is constitutively expressed in the T lymphocytes, and the second chimeric antigen receptor is inducibly expressed in the T lymphocytes. After the T lymphocytes come into contact with the target cells, the second chimeric antigen receptor is induced to express on the T lymphocytes upon antigen stimulation. When the first and second chimeric antigen receptors simultaneously recognize the first and second targets, the T lymphocytes are fully activated and exert their effector function.

The application relates to the fields of biotechnology and targeted therapy, and particularly relates to a recombinant construct, a CAR-T cell and construction and application thereof. The application verifies the role and mechanism of THEMIS in maintaining the long-term killing of tumor cells of CAR-T through experiments. The CAR-T cell overexpressing THEMIS is constructed, compared with a control group, the proliferation capacity and memory cell formation capacity of the THEMIS-7x19 CAR-T cell are enhanced after antigen stimulation, and the cytokines are in a controllable state, the cell apoptosis and exhaustion are reduced, and the long-term tumor killing capacity can be maintained more effectively. The in-vivo experiment also proves that the THEMIS-7x19 CAR-T cell has stronger anti-tumor effect compared with the control group in a lymphoma tumor-bearing mouse model, and the survival time of the mouse is significantly prolonged.

The invention relates to a chimeric antigen receptor for knocking down DMGDH gene expression and application of the chimeric antigen receptor, the chimeric antigen receptor comprises a plasmid structure capable of simultaneously expressing CD19CAR and knocking down T cell DMGDH expression, and the chimeric antigen receptor comprises a U6 promoter, an anti-DMGDH shRNA sequence started by the U6 promoter, an EF1 alpha promoter and a three-generation CD19CAR sequence started by the EF1 alpha promoter which are sequentially connected in series; the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: GCTCGGAGTATAAACAGGTTACTGAGTAACCTGTTTATACTCCGAGCTTTTT, and the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: The third-generation CD19CAR sequence is formed by connecting a CD19 single-chain variable region, a human CD8alpha hinge region, a human CD28 transmembrane region and intracellular region, an intracellular costimulatory region 4-1BB and a human CD3zeta intracellular region in series. After being subjected to antigen stimulation in vitro, the CART cells with the DMGDH expression knocked down show enhanced tumor cytotoxicity, lower cell depletion level and higher cytokine secretion capacity.

The invention relates to a tuberculosis antigen-specific host biomarker for diagnosing tuberculous pleural effusion and a kit, and belongs to the technical field of biological medicines. The host biomarker provided by the invention comprises the following components: IFN (interferon) gamma, IL-2 (interleukin-2), IL-12RB2 (interleukin-12R < 2 >), GZMB (Growth Zehnder Microorganism Blanket), IL-3 (interleukin-3), CXCL10 (C X-ray cell line 10), IL-12B (interleukin-12B), IL-18RAP ( According to the present invention, the mycobacterium tuberculosis RD1 region antigen or peptide fragment and the mycobacterium tuberculosis RD2 region antigen or peptide fragment are jointly used as the antigen irritants to stimulate the pleural effusion sample to be detected, and then the expression change of the host biomarker is detected so as to effectively identify and diagnose the tuberculous pleural effusion. By combining tuberculosis specific antigen stimulation and local infection microenvironment transcriptome analysis, the non-specificity defect of an existing host biomarker is overcome, and the host biomarker has high sensitivity and specificity in diagnosis of tuberculous pleural effusion.

The invention provides a TCR-T cell as well as a preparation method and application thereof, and belongs to the technical field of cell therapy. The preparation method comprises the following steps: stimulating a T cell by virtue of a carrier containing an SARS-CoV-2 antigen, so as to obtain the TCR-T cell specifically targeting the SARS-CoV-2 antigen. The specific TCR-T cell for recognizing the SARS-COV-2 antigen, which is obtained by stimulating T cells through the SARS-CoV-2 antigen, can be used as a universal TCR-T cell, and due to the fact that the specific TCR-T cell does not target an antigen from a receptor (patient), GVHD reaction cannot be caused, and GVHD caused by heterologous T cells can be reduced to the greatest extent.

The present application relates to a kind of in vitro T cell exhaustion function evaluation method and its application in immunotherapy efficacy prediction, belong to biological medicine technical field.The present application is by obtaining the T cell of subject source, constructs sustained antigen stimulation system in vitro, makes T cell form exhaustion related phenotype and functional change within a certain culture period, detects exhaustion related molecular marker expression and functional index change condition at preset time point, and based on HACD3 positive / negative subpopulation same sample in part layer comparison, establishes quantitative scoring model, for evaluating the exhaustion degree of T cell, to improve the accuracy and repeatability of immunotherapy efficacy prediction.The quantitative scoring model of the present application can be applied to the efficacy prediction and dynamic monitoring in treatment process of immune checkpoint inhibitor treatment, provide auxiliary basis for individualized treatment decision.

The invention provides an application of an MICAL1 activator in treatment of congenital toxoplasmosis, relates to the technical field of biomedicine, and has the technical key points that the application provides an application of MICAL1 as a target in preparation of a medicine for treating congenital toxoplasmosis, and the medicine achieves the purpose of improving the congenital toxoplasmosis by promoting the MICAL1. By constructing a congenital toxoplasmosis mouse model, it is verified that expression of MICAL1 in placenta tissue of mice infected by toxoplasma gondii is reduced. An in-vitro model for stimulating macrophages by using the excretion antigen secreted by the toxoplasma gondii verifies that the excretion antigen secreted by the toxoplasma gondii can inhibit the expression of the MICAL1. An MICAL1 activating agent Rab8A is injected into toxoplasma gondii to infect a pregnant mouse, and it is verified that the congenital toxoplasmosis can be remarkably improved by promoting expression of the MICAL1. Therefore, a new direction and medicine are provided for treating the congenital toxoplasmosis.

The application provides a monoclonal antibody of immunoglobulin A and application thereof, the monoclonal antibody is a specific monoclonal antibody of immunoglobulin A secreted by a mouse anti-human immunoglobulin A monoclonal antibody hybridoma cell line 5F5A4F3 strain, can be used for not only quantitative detection of the concentration of RBD-IgA generated by specific antigen stimulation, but also quantitative detection of the concentration of total IgA generated by mucosal immunity, and the ELISA method constructed based on the monoclonal antibody of immunoglobulin A is good in linearity, high in sensitivity and strong in specificity, is suitable for being used for evaluating the immunization effect of a vaccine, and is also suitable for being used for screening and monitoring the antibody level of IgA in a large-scale population.