DNA molecular machine and single-base mutation detection method based on DNA molecular machine as well as application of method

A DNA molecule and single base mutation technology, applied in the field of DNA molecular detection, to achieve the effect of simple detection means and simple operation

Inactive Publication Date: 2014-02-12
UNIV OF SCI & TECH OF CHINA
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Therefore, in order to overcome the difficulties in the detection of single-base mutations in DNA in the prior art, the inventors have conducted in-depth research and found that the detection of single-base mutations can be realized under simple operations based on DNA molecular machines combined with the assembly of gold nanoparticles. Detection, in the further search of the existing technical literature, there is no experiment that triggers the DNA molecular machine through the catalytic chain with a single base mutation at room temperature to promote the assembly of gold nanoparticles. In addition, there is no experiment that combines DNA molecular machines with gold nanoparticles. A report on the detection of single base mutations by controlled assembly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA molecular machine and single-base mutation detection method based on DNA molecular machine as well as application of method
  • DNA molecular machine and single-base mutation detection method based on DNA molecular machine as well as application of method
  • DNA molecular machine and single-base mutation detection method based on DNA molecular machine as well as application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] In the first step, probe chain 1 and probe chain 2 are modified on the surface of gold nanoparticles by using the reaction between thiol and gold:

[0037] ①Mix the oligonucleotide and 13nm nano-gold with a molar concentration ratio of 350:1, and store at 4°C for 16 hours;

[0038] ② Add final concentration of 10mM phosphate buffer and store at 4°C for 12 hours;

[0039] ③Add concentrated NaCl solution to change the final concentration from 0.1M to 0.2M and then to 0.3M, and store at 4°C for 8 hours at each concentration;

[0040] ④Centrifuge at 13000rpm for 30 minutes, discard the supernatant;

[0041] ⑤Add 10mM phosphate buffer, wash twice with final concentration of 0.1M NaCl;

[0042] ⑥Add 10mM PBS, 0.1M NaCl, pH=7.4, store at 4°C.

[0043] ⑦The concentration of 13nm nano-gold solution is determined by the ultraviolet absorption peak at 520nm wavelength.

[0044] The second step, annealing to prepare binary hybrid strands:

[0045] a. Dissolve the connecting chai...

Embodiment 2

[0068] Adopt the same operating steps as in Example 1, but reduce the 5' end of the protective chain by one base, resulting in a change in the structure of the DNA molecular machine, 22=5, 24=6 in the example 1, in this example 2 District=5, District 24=7. It is also possible to effectively distinguish the presence of base mutations in about 4 hours. UV dynamic process see figure 2 b.

[0069] Sequence of connecting strands (5'-3' from left to right)

[0070] CATCCCACTCCACCTTCATCTCACTACGATCCTCACTCTCACCCTAC

[0071] Sequence of protective strands (5'—3' from left to right)

[0072] AGTGAGATGAAGGTGGAGTG

[0073] Sequence of thiol-modified probe 1 (5'—3' from left to right)

[0074] SH-TTTTTTTTTTTTTTGTAGGGTGAGAGTGA

[0075] Sequence of thiol-modified probe 2 (5'—3' from left to right)

[0076] SH-TTTTTTTTTTTTTTGTAGTGAGATGAAGGTGGAGTGGGATG

[0077] Fully complementary catalytic strand sequence (5'-3' from left to right)

[0078] AGATCGTAGTGAGATGAAGGTG

[0079] Sequences...

Embodiment 3

[0082] The same operation steps as in Example 1 were adopted, except that the gold nanoparticles modified by the probe chain 1 were mixed with the binary hybridization chain at a molar ratio of 1:21. The presence of base mutations can be effectively distinguished when the reaction is carried out for about 4 hours. UV dynamic process see figure 2 c.

[0083] Sequence of connecting strands (5'-3' from left to right)

[0084] CATCCCACTCCACCTTCATCTCACTACGATCCTCACTCTCACCCTAC

[0085] Sequence of protective strands (5'—3' from left to right)

[0086] TAGTGAGATGAAGGTGGAGTG

[0087] Sequence of thiol-modified probe 1 (5'—3' from left to right)

[0088] SH-TTTTTTTTTTTTTTGTAGGGTGAGAGTGA

[0089] Sequence of thiol-modified probe 2 (5'—3' from left to right)

[0090] SH-TTTTTTTTTTTTTTGTAGTGAGATGAAGGTGGAGTGGGATG

[0091] Fully complementary catalytic strand sequence (5'-3' from left to right)

[0092] AGATCGTAGTGAGATGAAGGTG

[0093] Sequences with single base mutations (5'-3' fr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA molecular machine and also provides a single-base mutation detection method based on the DNA molecular machine. The method comprises the following steps: initiating different running capabilities of the DNA molecular machine by utilizing different catalytic chains, combining assembly of gold nanoparticles, observing the reaction difference of a catalytic chain system in which completely complementary catalytic chains are added and the catalytic chain system with single-base mutation through a contrast experiment, and finally realizing the single-base mutation detection based on the DNA molecular machine. Strict operating conditions are not needed in the detection means, and the operation is simple. The detection means of the signal is simple and can be identified through colors and ultraviolet spectrums in actual application. The difficulty that complex operation exists or a precise instrument needs to be used for observation in a conventional detection technology is solved. The detected base mutation type is comprehensive and comprises all base mutation forms, namely base mismatch, base deletion and base insertion, and a mutation position of the detected DNA chain is random.

Description

technical field [0001] The invention relates to the technical field of DNA molecular detection technology, in particular to a DNA molecular machine, a single base mutation detection method based on the DNA molecular machine and an application thereof. Background technique [0002] Single-base mutation is a ubiquitous gene variation type, and almost 1% of alleles in the human genome will have single-base mutation. The detection of single base mutations is now attracting more and more attention, because the variation in the human DNA sequence has great significance for the diagnosis of diseases and the design of drugs. [0003] So far, there are many methods to realize single base mutation detection, among which the important methods are enzyme-assisted method and DNA hybridization method. The enzyme-assisted method can be operated at room temperature and has high sensitivity and strong specificity, but the operation process is complicated, and the specificity of the reaction...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68C12N15/10
Inventor梁好均宋廷结肖石燕
OwnerUNIV OF SCI & TECH OF CHINA